Free
Abstracts  |   December 2019
2019 AOA Research Abstracts and Poster Competition
Article Information
Abstracts   |   December 2019
2019 AOA Research Abstracts and Poster Competition
The Journal of the American Osteopathic Association, December 2019, Vol. 119, 46-143. doi:https://doi.org/10.7556/jaoa.2019.128
The Journal of the American Osteopathic Association, December 2019, Vol. 119, 46-143. doi:https://doi.org/10.7556/jaoa.2019.128
This issue of The Journal of the American Osteopathic Association (JAOA) features abstracts from the posters that were presented at the 62nd Annual American Osteopathic Association (AOA) Research Dissemination Track. 
This year's abstracts were organized into the following categories: 
  • Basic Science
  • Clinical
  • Health Services
This year's AOA Research Dissemination Track took place in Baltimore, Maryland, on Friday, October 25, and Saturday, October 26, 2019, during the AOA's 2019 Osteopathic Medical Conference and Exposition (OMED 19). Abstracts submitted by students for the poster competition (designated with “*”) were judged, and the first- and second-place winners were announced at OMED 2019 Student Poster Competition and New Research Grant Recipients Networking Reception Awards Ceremony (designated with “★”). 
To enhance the readability of this special feature, abstracts have been edited for basic style only. The content has not been modified; information provided reflects information that was submitted by the primary author, including professional degrees and affiliations. Neither the AOA's Bureau of Clinical Education and Research nor the JAOA assume responsibility for the abstracts’ content. 
Basic Science
*B2—Chronic Diseases and Conditions
Cardiac Damage by Doxorubicin Is Mitigated in Smad3 Deficient Mice 
Kyle Mackenzie Campbell, OMS III1; Edward Dorfman, OMS II1; James Yang, OMS IV1; Melissa Cobb, MS2; Magdy Girgis, 3; Jeryl Hauptman, 3; Shixin Tao, PhD2; Robert Vincent, 3; Dawn Buddhadeb, 3; Eugene Konorev, PhD, MD1 
1Kansas City University of Medicine and Biosciences 
2Research Department, Kansas City University of Medicine and Biosciences 
3The University of Nevada, Las Vegas School of Medicine 
Statement of Significance: Cardiovascular disease is the leading cause of morbidity and mortality in long-term cancer survivors. Chemotherapy with doxorubicin and other anthracyclines is the most common cause of cardiac toxicity in treated cancer patients. These agents are used to manage both hematologic and solid-tumor malignancies. Cardiac manifestations often develop months to years after initial exposure, causing cardiomyopathy and heart failure. Osteopathic medicine approaches disease in a holistic manner attempting to prevent major complications earlier in the disease course. Preventing or reducing chemotherapy-induced cardiotoxicity would greatly improve the outlook for these patients and their overall wellbeing. 
Methods: Smad3+/+ wild type (WT), Smad3+/-, and Smad3-/- mice were treated with 4 weekly doses of doxorubicin, 5 mg/kg each, for a total dose of 20 mg/kg. Control groups of mice were treated with saline. The mice were killed 1 to 9 weeks after the completion of therapy and their hearts harvested in order to perform histological, immunohistochemical, and functional analyses. This allowed us to compare the effects of doxorubicin in mice with and without the SMAD3 gene. 
Data Analysis: We used transthoracic echocardiography to measure cardiac function in Wild Type and Smad3 deficient mice. We then conducted a cardiac vessel analysis using immunohistochemistry. Parameters measured were vascular area, capillary and arteriolar density, and cardiac fibrosis. We also measured the weights of hearts to look for changes between wild type and Smad3 deficient mice. 
Results: Using transthoracic echocardiography, we detected depressed cardiac function in doxorubicin treated WT mice but not in Smad3-deficient mice. Specifically, ejection fraction and radial strain were increased in doxorubicin treated Smad3 deficient mice compared with WT mice while the cardiac function was decreased in WT mice but unchanged in Smad3 deficient mice. Cardiac vessel analysis indicated a trend of increasing vascular area in doxorubicin-treated mice vs saline-treated mice. There were no differences in capillary and arteriolar density, heart weight, and cardiac fibrosis area between saline- and doxorubicin-treated hearts. 
Conclusion: Doxorubicin-induced contractile and vascular defects were attenuated in Smad3-deficient mice, highlighting the importance of the TGFβ pathway in the development of cardiomyopathy. The inhibition of TGFβ/Smad3 pathway is a feasible approach to alleviate doxorubicin-induced cardiotoxicity in treated cancer patients. Preventing chemotherapy-induced cardiotoxicity would vastly improve the outlook for patients treated with anthracyclines. This research fits into the osteopathic approach to patient care by focusing on a disease pathway at a point before symptoms arise when it is too late for prevention. 
Acknowledgment/Funding Source: This work was supported by grant R15HL133873 from the NIH National Heart, Lung, and Blood Institute. 
*B3—Chronic Diseases and Conditions
Overexpression of CST1 Leads to Altered EMT Signaling 
Nicole Jeong Ha Lee, OMS II1; Alexis Smith, MS1; Earl Garcia, MS1; Daniel Keppler, PhD2; Athena W. Lin 
1Touro University California College of Osteopathic Medicine 
2College of Pharmacy, Touro University California College of Osteopathic Medicine 
Statement of Significance: CST1 is highly expressed in certain senescent cells and cancer cells but remains poorly understood. Among the cystatins, CSTA, CST5, and CST3 have been shown to inhibit EMT. However, it is not known if CST1 plays any role in EMT progression. Considering the potential benefit in targeting EMT to help halt metastasis and reduce chemoresistance, it is of great interest to further our understanding of the intricacy of EMT signaling networks. Results obtained from this study are expected to help shed light into the biological role of CST1 in EMT and future cancer therapeutic development. This project highlights the interconnectivity of systems by focusing on the biomolecules involved in growth and circulatory transport of tumor cells. 
Methods: Human breast carcinoma MDA-MB-231 cells were stably transduced with control vector, CST1 or CST6 cDNA by retroviral gene transfer. After transduction and selection, the cell lines were treated with 60 nM Taxol or DMSO for 7 hours prior to collection of cell pellets for analysis. Levels of EMT signaling molecules were analyzed by Western blotting using specific antibodies and HRP-conjugated secondary antibodies. Chemiluminescent signals on the blots were imaged using a ChemiDocTM XRS+ Molecular Imager fitted with Image LabTM Software. 
Data Analysis: Relative intensities of chemiluminescent signals were compared between treated and untreated cell lines and responses of CST1-transduced cells compared with that of vector controls. Image analysis was done using NIH's ImageJ and Microsoft Excel. 
Results: CST1-transduced cells exhibited reduced expression levels of mesenchymal markers Snail and ZEB1. Moreover, low dose Taxol treatment of MDA-MB-231 cells led to increased expression of vimentin, Snail, and ZEB1, reduced phosphorylation of AKT1, and little to no change in β-catenin and phosphorylated GSK-3β. Interestingly, while cells transduced with CST1 exhibited increased expression of vimentin upon Taxol treatment in a manner comparable to the treated vector control, little to no change in Snail or ZEB1 was detected in CST1 transduced cells upon Taxol treatment. 
Conclusion: Our data suggest that CST1 may inhibit the EMT process by downregulating expression of transcription factors Snail and ZEB1 in MDA-MB-231 triple-negative breast cancer cells. Furthermore, the result suggests that low dose Taxol may activate EMT signaling. This mechanism, however, is blocked by the transduction of CST1. Breast cancer is the most common type of cancer affecting women. While chemotherapy continues to be the gold standard, prognosis remains poor. Treatment regimens commonly include Taxol, but nearly one-third of Taxol-resistant breast cancers are triple-negative. The role of cysteine protease inhibitors is a topic of focus in the development of novel chemotherapeutic agents, although their role in breast cancer remains under-investigated. In this study, we observed the inhibitory function of CST1 on low-dose Taxol-induced increase in EMT in a triple-negative breast cancer cell line. Future studies should aim to elucidate the mechanism by which CST1 expression inhibits EMT and potential role of this novel avenue in cancer therapy. 
Acknowledgment/Funding Source: This study is sponsored by the Department of Basic Sciences at Touro University California-College of Osteopathic Medicine and the College of Pharmacy. 
*B4—Musculoskeletal Injuries and Prevention
The Link Between Step Width and Pelvic Compensatory Mechanisms in Hip Osteoarthritis 
Michelle Kikel, OMS III1; Rachel Gecelter, OMS III1; Nathan E. Thompson, PhD2 
1New York Institute of Technology College of Osteopathic Medicine 
2Department of Anatomy, New York Institute of Technology College of Osteopathic Medicine 
Statement of Significance: Hip osteoarthritis (OA) causes patients to experience pain, stiffness and swelling leading to reduced function and disability. Patients with hip OA walk with characteristic compensatory gait strategies. Notably, they tend to either decrease pelvic obliquity on the affected side leading to a Trendelenburg gait or increase pelvic obliquity leading to pelvic elevation. Patients also either increase or decrease step width. Despite documentation of these patterns, the relationship between factors underlying these compensatory mechanisms are not fully understood. It's unknown how either are related to whole-body stability and balance in the frontal plane, nor why certain participants would adopt one or the other strategy. 
Methods: This study was approved by the NYIT Institutional Review Board. Human participants without any gait abnormalities were recruited to participate in the study, and were instructed to adopt gaits that mimic those seen in hip OA patients. This was done in order to get a more detailed look at the relationships between these select biomechanical factors while avoiding the sagittal plane gait abnormalities and asymmetric gait patterns that hip OA patients typically experience. 3-dimensional (3-D) kinematic data was collected as participants walked on AMTI force plate treadmill. Kinematic data was recorded using a 12-camera Vicon system at 150 frames per second and using the plug-in gait full body marker set. All data was collected with the participants walking on the treadmill at 1.0 m/s. Participants were first instructed to walk with normal, narrow and wide step widths. Narrow and wide step widths for each participant was calculated based on their normal step width. The target for wide step width was 2x that of normal step width and the target for narrow step width was a step width of zero. Following this, participants were instructed to walk with a 3 types of pelvis motions normal, pelvic drop and pelvic elevation. These pelvic motions were selected to mimic the gait of patients with hip OA. For each pelvic motion, trials for each of the prescribed step width conditions were also recorded. 
Data Analysis: All 3-D marker kinematic data was filtered using a Woltring filter. Marker positions and joint angles were calculated using Vicon Nexus. Step widths were calculated using custom written script using MATLAB. 
Results: Initial results indicate that when compared with walking with normal pelvic conditions, walking with a Trendelberg-like pelvic drop caused a decrease in step width (∼20%). When walking with pelvic hike, there was found to be about a ∼15% increase in step width compared with normal walking. Forcing participants to walk at narrow step widths resulted in a pattern of pelvic obliquity that was similar to normal walking, but with a ∼35% decrease in range of motion (ROM). Wide step width further reduces in pelvic ROM by ∼50% when compared with normal walking. More noticeably, the wide steps caused pelvic obliquity to begin to reverse direction in the latter portion of the stance phase when compared with normal walking. Hip abduction and adduction range of motion was not significantly different between the normal, narrow and wide step width groups but the average positions of the hip differed between conditions. Compared with normal step widths, wide steps resulted in more hip abduction whereas narrow step widths resulted in more hip adduction. 
Conclusion: Initial results suggest a relationship exists between induced pelvic motion and step width. A direct relationship was found between pelvic obliquity and step width when controlling for pelvic motion. When the pelvis dropped, the step width decreased and when the pelvis was elevated, the step width increased. When the step width was controlled for, the range of motion of pelvic obliquity was reduced for both the narrow and wide step widths when compared with a normal step width. However, wide steps also caused pelvic obliquity to change directionality, leading to slight elevation on the swing side towards the end of stance. Preliminary results suggest that step width likely has implications in support and stability during gait. Hip OA patients who have issues with gait stability may ultimately select to walk with wide-based gaits as it may provide additional stability. Patients without stability issues may actually seek to minimize abductor muscle force, which is done with narrower steps leading to a Trendelenberg gait. 
Acknowledgment/Funding Source: This research was supported by The National Science Foundation SMA 1719432 to NET. 
*B5—Chronic Diseases and Conditions
Making a Case for the DDX11 Encoding Helicase in Telomere DNA Replication 
Emily Seltzer, OMS III1; Tshering C. Sherpa, OMS II2; Mian R. Zoha, OMS II2; Dong Zhang, PhD2 
1New York Institute of Technology College of Osteopathic Medicine 
2Department of Anatomy, New York Institute of Technology College of Osteopathic Medicine 
Statement of Significance: Replicative immortality of cancer cells requires lengthening of telomeres. Cancer cells may reactivate telomerase (85-90%), or adapt the Alternative Lengthening of Telomere (ALT) pathway (10-15%). Currently, chemotherapy, which is toxic and non-specific, is the only treatment option for ALT cancers. 
DDX11, a DNA helicase, functions in DNA repair pathways and maintaining stabilization of the genome. Mutation of DDX11 is up-regulated in a diverse set of tumors such as advanced melanoma, colorectal cancer, and cervical cancer. Rational treatment is based on understanding the interrelationship of structure and function. Here we are aim to gain understand DDX11 knockdown effects cancer cells and possible treatment alternative to cancer. 
Research Methods: Using siRNA transfection, FANCM and DDX11 were depleted in U2OS, osteosarcoma ALT cancer cells. FANCM was used as a positive control and Luciferase was used as a negative control. Following transfection, cells were stained with antibodies recognizing either BLM, or pRPA, markers for replication stress, and TRF2, a telomere marker, and then visualized using fluorescent microscope. 
Data Analysis: Foci colocalization between the DNA damage markers, BLM or pRPA, and a telomere marker, TRF2, was quantified for each transfection. P-values were determined for DDX11 foci against the luciferase foci using an independent t test. 
Crystal violet assays were also performed to assess the viability of siRNA transfected cells. 
Western blot was utilized in determining knockout efficacy of DDX11. 
Results: 1. DDX11 may be involved in ALT telomere biology since depletion induces BLM foci at telomeres. 2. DDX11 does not affect DNA end resection at ALT telomeres since depletion does not induce pRPA foci formation. 3. DDX11 may function in the same pathway as FANCM since depletion of which does not form more BLM and pRPA foci, and does not exacerbate the viability of U2-OS cells. 
Conclusion: Our results indicate that FANCM and DDX11 may function similarly in suppressing the replication stress at ALT telomeres, which is crucial for the viability of ALT cells. Our findings presented here suggest that simultaneous inhibition of DDX11 and another factor would work similar to the suppression of FANCM alone, and expands our understanding of the mechanism in which FANCM and other helicases target ALT cancers. 
*B7—Chronic Diseases and Conditions
FUNDC1 Is Required for the Maintenance of Normal Cardiac Function During Fasting 
Katrina Sidney Bantis, OMS II1; Satoru Kobayashi, PhD2; Youhua Zhang, MD, PhD2; Qiangrong Liang, MD, PhD2 
1New York Institute of Technology College of Osteopathic Medicine 
2Department of Biomedical Sciences, New York Institute of Technology College of Osteopathic Medicine 
Statement of Significance: Osteopathic philosophy teaches that there's significant potential to heal without immediately resorting to drugs or procedures. Osteopathy's first tenet acknowledges humans’ ability to self-regulate to maintain homeostasis. The body is very capable of self-healing once it's been primed for optimal health. Mitophagy is a tightly-regulated process that allows cells to make dramatic changes to their constitution to combat stress. Osteopathic philosophy describes self-regulation and the interrelationship of structure and function, which are clearly supported by my hypothesis: disease ensues when mitophagy is disrupted. That's to say that when structure and function are separated, the cell (and by extension, the body) succumbs to dysregulation. 
Methods: We subjected FUNDC1 KO mice to 48-hours of complete caloric restriction. Mitochondria were isolated from fresh mouse cardiac tissues and used for western blot analysis of mitochondrial-associated proteins and stress markers. Cardiac functional status was assessed by echocardiography and hemodynamic measurement (via left ventricular catheterization). 
Data Analysis: Quantitative data, acquired from Image J and Western blot analysis, are expressed as mean ± SE and analyzed by χ2 test or ANOVA as appropriate with significance level set at P<.05. 
Results: Our cardiac function results demonstrate that two-day fasting impaired cardiac function in wild-type (WT) mice and that this dysfunction was exacerbated in FUNDC1 KO mice, suggesting that FUNDC1 or FUNDC1-mediated mitophagy is essential to the maintenance of cardiac function during fasting. The cardiac parameters assessed were heart rate (HR), fractional shortening (FS), ejection fraction (EF), maximal left ventricular pressure (Pmax), maximum rate of rise of left ventricular pressure (dP/dt max), minimum rate of rise of left ventricular pressure (dP/dt min), end systolic pressure (ESP), and Tau (a measure of left ventricular relaxation), in addition to other parameters. Moreover, western blotting analysis showed that phosphorylated, but not total, pyruvate dehydrogenase (p-PDH) expression was dramatically decreased in fed FUNDC1 KO compared with the fed WT mice, indicating an activation of PDH by FUNDC1 deficiency and, thus, increased use of the glycolytically derived substrate pyruvate in FUNDC1 KO heart. Interestingly, fasting markedly increased the p-PDH levels in the WT hearts but to a lesser extent than in the KO heart, suggesting that PDH activity remained relatively higher in the KO heart during fasting. 
Conclusion: Taken collectively, our findings demonstrated that FUNDC1 deficiency exacerbated cardiac dysfunction during fasting, which was associated with preserved PDH activity, suggesting an essential role for FUNDC1 in maintaining normal cardiac function during fasting. Studies are underway to determine the effect of FUNDC1 overexpression in transgenic mice on cardiac function during fasting-induced energy crisis. 
Acknowledgment/Funding Source: Supported by a grant from the American Osteopathic Association Grant Number: 2480MS1807605 and NIH grants. 
IACUC approval for this project is valid through 11/19/2019. 
References
1. Kerbey, A. L., et al. “Regulation of pyruvate dehydrogenase in rat heart. Mechanism of regulation of proportions of dephosphorylated and phosphorylated enzyme by oxidation of fatty acids and ketone bodies and of effects of diabetes: role of coenzyme A, acetyl-coenzyme A and reduced and oxidized nicotinamide-adenine dinucleotide.” Biochemical Journal 154.2 (1976): 327-348. 
2. Liu, L., Feng, D., Chen, G., Chen, M., Zheng, Q., Song, P., Ma, Q., Zhu, C., Wang, R., Qi, W., et al. 2012. Mitochondrial outer-membrane protein FUNDC1 mediates hypoxia-induced mitophagy in mammalian cells. Nat Cell Biol 14:177-185. 
3. Moyzis, A.G., J. Sadoshima, and A.B. Gustafsson, Mending a broken heart: the role of mitophagy in cardioprotection. Am J Physiol Heart Circ Physiol, 2015. 308(3): p. H183-H192. 
4. Ritterhoff, Julia, and Rong Tian. “Metabolism in cardiomyopathy: every substrate matters.” Cardiovascular research 113.4 (2017): 411-421. 
*B9—Chronic Diseases and Conditions
Comparison of the Keratin 18 Gene Dna Methylation Between Regular and Brain Metastasis Triple-Negative Breast Cancer Cells 
Benjamin Woodring Wolff, OMS II1; William J. Kohler, OMS II2; Tuoen Liu, MD, PhD2; Christopher Butler, BS2; Gabor Szalai, PhD3; Straight Benjamin, BS2; Paul Lockman, BSN, PhD2 
1West Virginia School of Osteopathic Medicine 
2Department of Biomedical Research, West Virginia School of Osteopathic Medicine 
3Department of Biomedical Research, Burrell College of Osteopathic Medicine 
Statement of Significance: Breast cancer is the most common type of cancer diagnosed in women. Patients with brain metastasis have a short mean survival time, and the effects of chemotherapeutic agents are minor. This is an osteopathic consideration that the inability to restore the body to homeostasis may cause continued decline in patients. In this study, we revealed the potential mechanism by which AZA has a positive effect in treating brain metastasis breast cancer. With a clear understanding of the mechanism of metastasis and drug treatment in breast cancer, osteopathic physicians can better treat their patients suffering from the disease. Refined treatment options will give patients an improved outlook, and ultimately help them maintain their healthy lifestyle. 
Research Methods: The study by Umezawa et al. showed that DNA methylation of intron 1 in the keratin 18 gene is important in regulating its expression. In our study, we compared the DNA methylation status of the intron 1 region (737 bp) of the keratin 18 gene between the regular MDA-MB-231 and brain metastasized MDA-MB-231 Br breast cancer cells. 
The detailed methodology include 6 major steps as follow: Step 1: The genomic DNA from both cell lines was isolated by using the GeneJET genomic DNA purification kit. Step2: The genomic DNA was treated with bisulfite to chemically modify non-methylated cytosines into uracil (methylated cytosines remain unchanged) by using the EZ DNA methylation-lightning kit. Step 3: 5 pairs of primers were designed and PCR was performed to fully cover and amplify the intron 1 region of the keratin 18 gene. Step 4: The PCR products were cloned into the pCR2.1-TOPO vector by using the TOPO TA cloning kit. Step 5: The cloning products were transformed into competent DH5 alpha E.coli cells. Step 6: The transformations were spread on ampicillin-selective plates and incubated. Colonies on the plates were picked up and cultured, and plasmid DNA was purified by using the plasmid purification kit. The purified DNA was then sent for sequencing. 
Data Analysis: Five of the purified plasmid DNA with correct PCR inserts were sequenced and the DNA methylation status between the 2 cell lines were compared. 
Results: (1) The DNA sequence of intron 1 of the keratin 18 gene is identical between MDA-MB-231 and MDA-MB-231 Br cells. We did not detect DNA mutation or deletion of the intron 1 region of the keratin 18 gene between both cell lines, suggesting the decreased expression of keratin 18 in MDA-MB-231 Br cells may due to DNA hypermethylation. 
(2) The DNA methylation status is different in intron 1 of the keratin 18 gene between MDA-MB-231 and MDA-MB-231 Br cells. We fully sequenced and compared the DNA methylation of the intron 1 region of the keratin 18 gene between both cell lines by using the bisulfite conversion method. In this method, treating DNA with bisulfite chemically modifies non-methylated cytosines into uracil (appears as adenine in DNA sequencing results), but methylated cytosines remain unchanged. We found 3 cytosines were converted into uracil in MDA-MB-231 cells while they remained unchanged in MDA-MB-231 Br cells, suggesting the DNA methylation status of the keratin 18 gene is different between both cell lines. 
Conclusion: In this study, we found that the keratin 18 gene is hypermethylated in brain metastasized breast cancer cells, which is important in regulating its expression and response to hypomethyalting agent treatment. Based on our findings, the hypermethylated keratin 18 gene can be a potential drug target used for the development of novel targeted therapy drugs in treating patients with brain metastasis breast cancer. 
Our future plan will investigate the functions and mechanisms of the methylated cytosine sites and how they will affect the expression of the keratin gene and response to hypomethylating agent treatment. 
Acknowledgement/Funding Source: This work is supported by West Virginia Clinical and Translational Science Institute (WVCTSI) pilot grant (Lockman and Liu) and West Virginia School of Osteopathic Medicine intramural grant (Liu). 
*B10—Musculoskeletal Injuries and Prevention
Using ClearEdge™ to Assess the Effects of Subconcussive Events on Neurocognition and Balance 
Matthew Geiselmann, OMS II1; Taesung Kim, OMS II2; Katherine M. Keever, OMS II2; Caroline Varlotta, OMS IV2; Brandon Burg, OMS III2; Joseph Miceli, OMS III2; Hallie Zwibel, DO3; Matthew Heller, DO3 
1New York Institute of Technology College of Osteopathic Medicine 
2New York Institute of Technology College of Osteopathic Medicine (NYITCOM-LI) 
3NYIT Center for Sports Medicine 
Statement of Significance: Sports-related mTBI can be detrimental for collegiate athletes who are still developing regions of their brains (5). By having a better understanding of injury patterns and symptomatology caused by head trauma in men's collegiate athletics, physicians and medical personnel can detect head injuries earlier and more accurately. The sequelae of mTBI extend beyond performance on the field; function in school, work, social and emotional relationships can also be compromised (1). Helping physicians understand and identify the complexity of concussion symptoms and their toll on an athletes’ physical, social and emotional well-being will allow them to take a more holistic approach during treatments and guide osteopathic treatment models. 
Methods: 17 NCAA Division II collegiate men's lacrosse players were enrolled under approved IRB protocol number BHS-1304 prior to their 2019 season (January - June). Participation was voluntary and recruitment was done by NYIT physicians. Each athlete was instructed to wear an Athlete Intelligence Cue™ Sport accelerometer in their helmet during practice and competition to measure and record impacts. Deidentified data were obtained with the assignment of a thirteen character alphanumeric code. ClearEdge™ testing assessed athletes’ concussion symptoms, cognitive ability and balance at 3-time points: preseason (baseline), midseason and postseason. ClearEdge™ testing consisted of 2 components: DANA™ Essentials and Motion™. Neurocognitive function was tested using ClearEdge DANA™ Essentials. DANA™ consists of 4 tests: simple reaction time (SRT), procedural reaction time (PRT), Go-No-Go (GNG) and simple reaction time part 2 (SRT2). Simple reaction time is tested twice to assess for fatigue and possible malingering (6). Balance and stability was tested using ClearEdge Motion™. Motion™ testing is performed using the Edge™ Sensor, a wireless inertial measurement unit fitted with an accelerometer, gyroscope and magnetometer specifically designed to measure subtle changes in balance and sway (6). As the test progresses, Motion™ tests vary in difficulty. Performance on all tests were automatically recorded in the ClearEdge portal for later analysis. 
Data Analysis: Numerical performance scores were automatically recorded once testing was completed. DANA™ neurocognitive function tests included: SRT, PRT, GNG, and SRT2. Motion™ consists of 8 different balance and stability tests, each increasing in difficulty: eyes open with feet side by side (EOSM), eyes closed with feet side by side (ECSM), eyes open with tandem stance (EOTM), eyes closed with tandem stance (ECTM), eyes open with feet side by side on foam pad (EOSF), eyes closed with feet side by side on foam pad (ECSF), eyes open with tandem stance on foam pad (EOTF), and eyes closed with tandem stance on foam pad (ECTF). Data reports can be accessed via a HIPAA compliant server for analysis. Change over the pre-, mid-, and postseasons in each of ClearEdge test outcomes was compared using the repeated measures analysis of variance followed by the pairwise comparisons with the preseason as a reference. For all the statistical tests, significance was evaluated with α=.05. 
Results: A decrease in neurocognitive function, balance and stability were observed over the course of the season. PRT, a measurement of accuracy, reaction time and impulsivity increased from a score of 96.9 in preseason, to 102.1 in midseason, and declined to 90.3 in postseason. PRT scores changed significantly across our 3 testing periods (P=.006). EOSM decreased from a score of 85.6 in preseason to 84.9 in midseason, and 80.6 in postseason. EOSM scores changed significantly across our 3 testing periods (P=.039). Composite aggregate stability measurement (ASM), a metric comparing performance on varying balance challenges, initially increased from a score of 84.3 in preseason to 85.0 in midseason and declined to 82.9 in postseason. ASM scores changed significantly across our 3 testing periods (P=.05). 
Conclusion: ClearEdge™ performance scores show a statistically significant decline in neurocognitive function and balance over the course of the season, supporting our hypothesis. Significant declines were noted in PRT, ASM, and EOSM across our 3 testing periods. 
Limitations in the study prevent correlation of cognitive decline to the number of impacts sustained by each athlete possibly due to athlete compliance issues. Athletes wore 2 different model helmets and experienced difficulty transferring and charging Cue™ Sport accelerometers. Further investigation and experimental design is required to better understand these findings and further assess a link between the number of subconcussive impacts and a decline in balance and neurocognitive function. 
Acknowledgment/Funding Source: A special thank you to my physician mentors, Hallie Zwibel DO and Matthew Heller DO for the opportunity to work on this project. I would also like to acknowledge Min Kyung-Jung PhD for performing the statistical analysis and Simon Katz for assisting in data collection. Funding from this study came from an NYIT In-House Grant. 
References
1. Kenzie ES, et al. Concussion As a Multi-Scale Complex System: An Interdisciplinary Synthesis of Current Knowledge. Front Neurol. 2017;8:513. Published 2017 Sep 28. 
2. Marmar M, et al. Epidemiology of concussions among United States high school athletes in 20 sports. AM J Sports Med. 2012 Apr;40(4):747-55. 
3. Echemendia RJ, et al. Developing guidelines for return to play: consensus and evidence-based approaches. Brain Inj. 2015;29(2):185-194. 
4. Comeau D, et al. Diagnosis of concussion on the sidelines. Semin Pediatr Neurol. 2019 Jul;30:26-34. Epub 2019 Mar 26. 
5. Miller DJ, et al. Prolonged myelination in human neocortical evolution. Proc Natl Acad Sci U S A. 2012;109(41):16480-16485. 
★*B11—Chronic Diseases and Conditions
Role of Leptin and Its Receptor in the Protective Effects of HSP70 Against Diet-Induced Obesity 
Philip Song, OMS II1; Pytynia Matt, BS2; Karlee Kirkpatrick, OMS III1; Christian C. Evans, PT, PhD3; Mae J. Ciancio, PhD2 
1Midwestern University Chicago College of Osteopathic Medicine 
2Department of Biomedical Sciences 
3Department of Physical Therapy, Midwestern University Chicago College of Osteopathic Medicine 
Statement of Significance: Reducing obesity will lead to an improvement in the body's overall function, general health, and a more robust response to osteopathic manipulative treatment. Heat shock protein 70, a stress-inducible protein, has been shown to prevent DIO in rodents. The Ciancio laboratory demonstrated that transgenic mice over-expressing Hsp70 (Hsp70 TG) selectively in villin-expressing mature epithelial cells were protected from DIO. This effect was not caused by a significant change in food consumption. Leptin has a well-recognized role in calorie consumption and systemic inflammation. Leptin receptors have metabolic effects in peripheral organs in addition to its role of inhibiting food intake in the hypothalamus. 
Methods: Serum leptin levels were determined by MagPix Assay in blood collected from Hsp70 TG and NTG littermates that received either a low fat (10 kcal% fat; Research Diets, Inc) or high fat (60kcal% fat; Research Diets, Inc) diet for 14 weeks (n=12 per group). Livers (n=7 per group) were harvested and flash frozen in liquid nitrogen and stored at -80°C. RNA was isolated from each liver using the Trizol method, reverse transcribed into complementary DNA (High-Capacity cDNA Reverse Transcription Kit, ThermoFisher Scientific), and measured for relative levels of ObR expression using qPCR (primers: R=5’ CACTCTGTCCCAGTTTACA 3’; F= 5’ CAACACTGAAGGGAAGACACT 3’). GAPDH was used to normalize the results (R= 5’ TTTGATGTTAGTGGGGTCTCG 3’; F= 5’ AGCTTGTCATCAACGGGAAG 3’). qPCR results were calculated to determine the 2–ΔΔCt for analysis of relative messenger RNA levels in each processed sample. Intracellular protein was extracted, analyzed for concentration using the bicinchoninic assay method, and used to determine leptin receptor expression by Western Blot (AF497, R&D Systems). HSC70 was used to normalize relative protein loading per sample (SC-1059, Santa Cruz Biotechnology). Image Lab software was used to determine the relative signal intensity of the Western blots. Soluble leptin receptor levels will be determined by ELISA (DY497, R&D Systems) using serum previously collected and stored at -80°C. 
Data Analysis: Data is expressed as mean + SEM. All data were analyzed by a 2-way ANOVA followed by a Holm-Sidak's posthoc test for within group comparisons using GraphPad Prism. Significance was determined at P<.05 trend at .05<P<.10. 
Results: Serum leptin levels were significantly elevated in all HF diet mice (10.5 + 0.9 and 9.3 + 1.9 ng/ml, HF/NTG and HF/TG, respectively) compared with their littermates on a LF diet (3.8 + 0.8 and 3.3 + 0.5 ng/ml, LF/NTG and HF/TG, respectively). Relative liver ObR messenger RNA expression, as determined from RT-qPCR, was significantly reduced in mice on a HF diet (0.25 + 0.04 and 0.33 + 0.07, HF/NTG and HF/TG, respectively) compared with mice on a LF diet (0.901 + 0.05 and 1.26 + 0.19, LF/NTG and LF/TG, respectively). Hsp70 TG mice demonstrated a trend for greater relative ObR expression compared with their NTG littermates on their respective diets (P=.056). Studies are still in progress for determining the relative levels of hepatic ObR protein expression and circulating ObR levels. 
Conclusion: Circulating leptin levels were elevated in all mice consuming a HF diet; Hsp70 TG mice demonstrated a comparable elevation in serum leptin, as did their NTG littermates. Contrary to the tested hypothesis, ObR mRNA levels were significantly reduced in all mice receiving a HF diet compared with their LF diet littermates. Hsp70 TG mice, however, demonstrated a significant increase in ObR mRNA expression compared with their respective LF and HF fed littermates. The decreased levels of leptin receptor expression may indicate the development of leptin resistance, which is a commonly associated finding with obesity. Hsp70 over-expression may reduce the severity of leptin resistance by increasing the receptor expression. A fuller understanding of the effects of Hsp70 over-expression on ObR protein expression are needed before any firm conclusions can be suggested. Additionally, measuring circulating ObR levels will provide further insight on whether the soluble leptin receptor levels differ between groups, which may play a role in Hsp70 mediated protection against DIO. If the ongoing experiments indicate a difference in leptin receptor expression due to HSP70 overexpression, further experiments will be focused on clarifying the connection between leptin and its receptor with Hsp70 overexpression and the observed protection against DIO. Understanding the role of inherent host defense mechanisms in preventing DIO have significant clinical implications as possible therapeutic options. 
Acknowledgment/Funding Source: This study was supported by the ORSP Kenneth A. Suarez Summer Research Award and intramural funding from Midwestern University. 
*B12—Chronic Diseases and Conditions
Combined Familial Hypercholesterolemia and Mineral Bone Disorder in Chronic Kidney Disease: A Mouse Model 
Alexandra Tsivitis, OMS II; Eric J. Schram, OMS II; Mohnish Singh, MS; Gregory D. Oliva, OMS II; Ryan J. Senese, DO; Olga V. Savinova, PhD 
Departent of Biomedical Sciences, New York Institute of Technology College of Osteopathic Medicine 
Statement of Significance: Patients with CKD are at increased risk to cardiovascular events and osteoporosis compared with the general population. FH is an inherited disorder that causes inability to remove low density lipoprotein (LDL) from the blood and poor cardiovascular prognosis. With our new mouse model, the interaction between CKD and hyperlipidemia can be studied to further understand how dyslipidemia in CKD can cause multi-system pathology in a holistic way. Since it is known that the immune system regulates bone remodeling and signaling as well as atherosclerosis, osteopathic lymphatic pump techniques may be indicated to upregulate the rebuilding of bone and decrease heart disease in CKD patients. 
Research Methods: CKD was induced by feeding mice a nephrotoxic 0.2% adenine-containing diet for 8 weeks with or without an atherogenic Western diet. All animals in our study had a mutation in the LDL receptor predisposing them to FH. 6 males and 6 females were studied in each treatment arm. Echocardiographic studies were performed at baseline and at upon completion of the study. At the end of the experiments, fasted plasma and formalin-fixed full body preparations were collected. Plasma inorganic phosphate, calcium, and creatinine were measured using colorimetric assays. Tissue slices were embedded in Optimal Cutting Temperature (OCT) compound and frozen. Kidney sections were stained with H&E for general pathology. Oil red stain was used to detect lipid deposition in the aortic root and the liver. Slides were examined under bright-field microscopy. Femora were dissected from formalin-fixed full body preparations and examined by micro computed tomography (microCT). X-ray source of a SkyScan 1173 microCT instrument (MicroPhotonics) was set at a voltage of 50 kV, with a current of 160 μA, and a 0.5 mm Aluminum filter. The data set was obtained with a voxel size of 10.7 µm. 3D image stacks were reconstructed from the rotation image projections using NRecon software (MicroPhotonics). After reconstruction, images were analyzed to obtain quantitative information of the bone structure using Dragonfly software (Object Research Systems Inc). 
Data Analysis: Data were analyzed using GraphPad Prism 8 software. Mean and SDs were calculated. Multiple groups were compared by the ANOVA or Kruskal-Wallis tests for parametric and non-parametric variables as appropriate. Significance was accepted at P<.05. 
Results: CKD mice had increased BUN, phosphate, and calcium when compared with controls. In CKD mice, the morphology of the renal cortex exhibited a non-uniform architecture along with extensive dilation of renal tubules with epithelial cell dropout and necrosis into the center, followed by leukocytic infiltration, eventually forming ring-like clusters within the renal. Glomerular destruction was also observed. Tubular microscopy revealed thyroidization in late stages of leukocytic infiltration. Control kidneys were normal. Bone volume, average trabecular and cortical thickness, periosteal surface, and endocortical surface were all significantly reduced in CKD mice when compared with controls. Contrary to our hypothesis, we found a significant reduction in plasma triglyceride levels in CKD mice compared with controls whereas plasma cholesterol was not different between the groups. CKD mice had significantly less atherosclerosis of the aortic root when compared with controls. To investigate this further, we analyzed lipid content within the liver. Histological assessment revealed that CKD female mice had reduced lipid deposits, whereas CKD males had no significant change in lipid deposits when compared with controls. Compared with controls, the CKD mice had a decreased heart rate and an increase in: left ventricular (LV) wall thickness (both anterior and posterior measurements), LV diameter, and stroke volume with increased ejection fraction, which preserved cardiac output. 
Conclusion: The levels of calcium and phosphate in the plasma of the mice treated with adenine indicate the presence of MBD. Changes in the cortical and trabecular bone, particularly bone volume fraction, further confirm MBD. An increase in plasma triglycerides in both groups compared with baseline was expected. However, this increase was only observed in the control group but not in the CKD group. Since both groups of mice suffer from FH, a proposed mechanism for this reduction in CKD mice may include excess adenine and purine synthesis. Adenine induced CKD has a metabolic side effect of reducing triglyceride synthesis and it may not be an appropriate model to study atherosclerosis in animals. More research to understand the pathophysiology of heightened cardiovascular risk in CKD. Understanding the role of purine synthesis in CKD and why it reduces lipid deposits in tissues and reduces risk for CVD in mice with FH and CKD may have clinical application for CKD patients. Finally, further quantification and research of the presence of osteoporosis in MBD-CKD mice may have clinical applications to patient comfort and care. 
Acknowledgement/Funding Source: The acquisition of the microCT scanner was made possible by a Major Research Instrumentation (MRI) grant from the National Science Foundation (NSF 1828305) to PIs Simone Hoffmann, Julia Molnar, Azhar Ilyas, Olga Savinova, and Claude Gagna and with the support of NYIT's College of Osteopathic Medicine (NYITCOM), College of Engineering and Computing Sciences, and College of Arts and Sciences. We thank Dr. Plummer for pathology consultation, and Kelsi Hurdle for technical assistance with microCT. 
*B13—Musculoskeletal Injuries and Prevention
Hip Muscle Activity and Mechanics in Osteoarthritis Gait 
Rachel Gecelter, OMS III1; Michelle Kikel, OMS III1; Nathan E. Thompson, PhD2 
1 New York Institute of Technology College of Osteopathic Medicine 
2Department of Anatomy, New York Institute of Technology College of Osteopathic Medicine 
Statement of Significance: Hip OA is one of the most common joint diseases in the US. This degenerative disorder leads to joint pain, reduced mobility, and physical impairment. As a result, patients with hip OA alter their gait in order to compensate for hip pain while still maintaining frontal plane balance during walking. However, different compensatory characteristics exist among hip OA patients, particularly in pelvic motion, step width, and muscle activity. Some hip OA patients adopt a ‘Trendelenburg Gait’ with increased step width and decreased gluteus muscle activity while others walk with an elevated pelvis, increased step width, and increased gluteus activity. Understanding differences between individual gait patterns may lead to more effective treatments. 
Methods: The study was approved by the New York Institute of Technology (NYIT) Institutional Review Board. Healthy participants in this study were recruited from NYIT. The inclusion criteria were participants without any musculoskeletal disorders and without pain walking. Kinematics were recorded via a 12-camera Vicon motion capture system using the standard full-body plug-in gait marker set. The participants then performed walking trials on an AMTI force-instrumented treadmill at a normal speed (1.0 m/s) under varying conditions. The conditions included variable step widths (normal step width, narrow step width, and wide step width) and variable pelvic motions which mimic those seen in hip OA patients (normal, exaggerated swing-side pelvic drop, and swing side elevation). Bilateral muscle activity of gluteus medius was recorded using a Noraxon surface electromyography (EMG) system. 
Data Analysis: Vicon Nexus was used to record EMG data and marker kinematics. Following data collection, EMG data was filtered with a 20-250 Hz band-pass filter, rectified, and a windowed (60 millisecond) root-mean-square average was applied using custom-written code in Matlab. 
Results: During normal step width trials, stance-side gluteus medius muscle activity decreased by ∼35% when participants performed the exaggerated swing-side pelvic drop gait and increased about ∼50% when participants performed the swing-side pelvic elevation gait. During the narrow step width condition, gluteus medius muscle activity similarly decreased by ∼40% when participants performed the exaggerated swing-side pelvic drop gait and increased ∼80% when participants performed the swing-side pelvic elevation gait condition. Finally, when walking with wide steps, gluteus medius muscle activity decreased by ∼15% when participants performed the exaggerated swing-side pelvic drop gait and increased ∼30% when participants performed the swing-side pelvic elevation gait condition. When comparing normal step width and wide step width trials and adjusting for each gait condition, gluteus medius muscle activity was on average ∼40% higher for wide step widths trials. 
Conclusion: Our results indicate that a swing-side pelvic drop always results in decreased gluteus medius activity, where as swing-side pelvic elevation always results in increased muscle activity. These results are consistent with the hypothesis that the gluteus medius exerts less force when the swing-side hip is dropped but requires more force in order to elevate the hip during swing-side hip elevation. Therefore, understanding the different muscle activity patterns in healthy patients can better delineate gait abnormalities in patients with hip OA. Notably, wider step widths entail higher gluteus medius muscle activity compared with normal step widths. This suggests that hip OA patients who elevate their swing-side hip may prioritize wider step widths for gait stability at the expense of increasing their gluteus activity. Narrow step widths are associated with swing-side pelvic drop and lower gluteal forces, likely reducing pain in patients without gait instability. 
Acknowledgment/Funding Source: The National Science Foundation NSF SMA 1719432 to NET. 
★*B14—Chronic Diseases and Conditions
Examining Interstitial Cajal Cell Networks Using a Mouse Model to Study the Effect of Calcification Induced Heart Failure on GI Dysmotility 
Senayt Alemu, OMS II1; Saad Quadri, OMS II2; Olga V. Savinova, PhD2 
1New York Institute of Technology College of Osteopathic Medicine 
2Department of Anatomy, New York Institute of Technology College of Osteopathic Medicine 
Statement of Significance: Understanding how the cardiovascular and GI systems function in conjunction with one another falls under an important osteopathic tenant - the body is a unit. Advances in this research may allow doctors to recognize GI disorders as a possible consequence of HF and maybe a therapeutic target prior to total failure of heart function. We believe a possible link between the dysfunctions of the heart and GI system is the interaction with the sympathetic nervous system and effects of hypoxia on the ICC networks due to hypoperfusion. Establishing this connection may allow for future studies on the effectiveness of osteopathic techniques, such as rib raising which can help regulate the sympathetic chain, on patients with GI complaints that have HF. 
Methods: We used endothelial TNAP (tissue-nonspecific alkaline phosphatase) overexpressed mice (eTNAP), to promote vascular calcification, and wild type (WT) mice as controls. Echocardiographic measures of heart function were used to assess the progression of HF in eTNAP mice using VisualSonics Vevo 3100 equipped with a 40 MHz transducer and analyzed in the VevoLab software. Previously, in partnership with the School of Engineering and Computing Sciences at NYIT, we tracked slow wave activity through the GI tract, in both WT and eTNAP mice using an in vivo recording. Subsequently, we harvested the GI tracts and used the small intestine (SI), cecum and colon to visualize the ICC via c-kit immunofluorescent staining. We followed the protocol used in the study for Visualization of the ICC Network in Mice (Chen 2011). After immunofluorescent staining, 5x5 mm sections of tunica muscularis of the 3 regions of interest for each mouse were mounted on slides, serosal side up, and examined by an Olympus BX53 Upright Microscope. Images were viewed under 20x objective and taken with standardized exposure time, and the depth of focus corresponding to Myenteric Plexus ICC network (ICC-MY) in the SI and cecum or Intramuscular ICC (ICC-IM) in the colon. We analyzed the images on a quantitative basis by enumerating the fluorescent area and intensity of ICC networks. In addition, 3 dimensional (3D) images were acquired using a Nikon confocal microscope to reconstruct network connectivity in 3D. 
Data Analysis: Data are presented as Mean ± SD. WT and eTNAP parameters were compared using parametric statistics computed in GraphPad Prism. Significance was accepted at P<.05. 
Results: When compared with WT mice, eTNAP mice had reduced body weight (P<.05), reduced left ventricular (LV) ejection fraction (P<.05) and increased LV mass index (P<.05) Upon comparing the immunofluorescent images of c-kit antibody stained ICC networks between WT and eTNAP mice, we did not see any prominent changes in the ICC networks in the SI or the colon. Surprisingly, the ICC-MY network area in the cecum of eTNAP mice was increased compared with WT (P<.05) suggesting a hypertrophic remodeling. 
Conclusion: Our study focused on the visualization of ICC networks within mice and conditions of HF and reduced slow wave amplitude. Our results lead us to believe the GI dysmotility found in vascular calcification induced HF may be caused by a systemic disturbance in the GI motility pattern, given that the integrity of the ICC networks remained. A proposed mechanism, given our understanding of the neuromodulatory effect on slow wave transmission, is that as a consequence of HF, the body reacts with sympathetic overactivity, inducing an inhibitory effect on the amplitude of slow waves, causing GI dysmotility. A lack of a reduction of ICC density strengthens our theory on the neuromodulatory effect of heart failure on the amplitude of slow waves. Further investigation should be done to assess levels of excitatory or inhibitory neurotransmitters as well as activity of the ANS in these mice groups to provide more evidence for our theory. Future studies on the effect of the ANS on the mechanisms of slow wave transmission may be a potential area of interest for drug therapy in gastric dysmotility disorders. 
References
1. Chen, Y., Shamu, T., Chen, H., Besmer, P., Sawyers, C. L., Chi, P. Visualization of the Interstitial Cells of Cajal (ICC) Network in Mice. J. Vis. Exp. (53), e2802, doi:10.3791/2802 (2011). 
*B15—Chronic Diseases and Conditions
Does Endothelial Tissue-Nonspecific Alkaline Phosphatase (TNAP) Play a role in Intracranial Calcification? 
Shadia Nahar Ahmed, OMS II; Nida Fatima, OMS II; Gregory Oliva, OMS II; Alexandra Tsivitis, OMS II; Raddy L. Ramos, PhD; Olga V. Savinova, PhD 
Department of Biomedical Sciences, New York Institute of Technology College of Osteopathic Medicine 
Statement of Significance: PFBC is often misdiagnosed for hyperparathyroidism or Parkinson disease as they share similar clinical manifestations. By exploring the pathogenesis of PFBC we can enhance the practice of diagnosis and attain a better physiological understanding of the clinical presentation. Since no current methods halt the progression of the disease, PFBC treatment primarily targets symptomatic support. We hypothesize that Osteopathic Manipulative Medicine (OMM) techniques aimed at treating the Parkinsonian-like symptoms of PFBC, along with traditional pharmaceutical methods (i.e bisphosphonate, disodium etidronate), can yield better improvements in the quality of life of patients. 
Methods: In order to induce TNAP overexpression, human alkaline phosphatase gene (ALPL) was inserted into a mouse model genome and activated via Cre/lox recombination. Our endothelial TNAP (eTNAP) overexpression mouse model was compared with a TNAP knockout model and wild type. In this study, we focused on the potential role of vascular TNAP levels on the choroid plexus. 
We quantitatively analyzed intracranial calcification with the Micro-Computed Tomography (micro-CT) instrument SkyScan 1173 and NRecon image reconstruction software. Reconstructed images were visualized and quantified, and intracranial calcification was analyzed in 3D via the Dragonfly 4.1 program (Object Research Systems (ORS) Inc., Montreal, Canada, available for academic use at http://www.theobjects.com/dragonfly). 
To collect CSF, we anesthetized mice with 5% isolurane in oxygen and positioned their head in order to enhance access to the base of the head. The mice sat over a warm pad during this terminal procedure. Under the microscope, a capillary tube was guided into the cisterna magna in order to extract CSF. Inorganic phosphate was measured via a colorimetric assay. 
Slides of cryosectioned mouse brains were stained for alkaline phosphatase activity. Slides of our eTNAP knockout and transgenic models were compared with controls under the bright field microscope. 
Data Analysis: Expression patterns of alkaline phosphatase in the brain was analyzed qualitatively from histological images. The amount of calcium deposits in the brain was expressed in mm3 or a % volume. These and other quantitative data (CSF measurements) were expressed as Mean ± SD. Data between 2 groups were compared using a t test or a Mann Whitney statistics dependent on the equality of variances, which was determined by an F test. Data were analyzed using GraphPad Prism 8 software. Significance was accepted at P<.05. 
Results: TNAP-induced calcification was detected in multiple regions of the brain (basal ganglia, thalamus, ventral tegmental area, brainstem, cerebellar nuclei) with Dragonfly. Using Dragonfly's features, we differentiated between extracranial and intracranial calcification, as well as between our TNAP overexpression model and the wildtype. Our findings showed significantly more intracranial calcification within the basal ganglia in our TNAP overexpression model. 
Through analysis of brain cryosections, we compared levels of alkaline phosphate activity in the vasculature and observed that activity followed the genetic pattern of TNAP expression in a predictable manner. But no correlation was seen between endothelial TNAP gene dosage (knockout, wild type, transgenic) and the level of alkaline phosphatase activity within the choroid plexus. There was also no differences detected in the concentration of inorganic phosphate in CSF between endothelial TNAP overexpression and wild type animals. Collectively these findings suggest that it is unlikely that endothelial TNAP in the choroid plexus is regulating phosphate transport or is responsible for intracranial calcification. 
Conclusion: PFBC is a rare, autosomal dominant, age related phenomenon primarily seen after the age of 40. Prior studies refer to the intracranial calcifications as “brain stones,” which are mostly composed of hydroxyapatite, the same calcium-phosphate structure found in normal bone. After observing the involvement of TNAP expression in intracranial calcification we concluded that TNAP can be a therapeutic target for PFBC and similar conditions. However, the causative role of choroid plexus in intracranial calcification is yet to be determined and requires further research. 
The effectiveness of OMM is difficult to interpret in mouse models and therefore should be done in human trials noting improvement in movement and observing the progression of intracranial calcification via imaging. Osteopathic treatment goals include strengthening muscles, increasing range of motion, reducing edema, eliminating motion restriction and stretching soft tissues. With the goals in mind, possible treatment options include myofascial release to eliminate motion restriction, as well as muscle energy of postural muscles or myofascial stretch of cervical/thoracic spine to improve postural stability and shuffling gait. Possible future endeavors include exploring cranial osteopathic manipulations of CSF, pioneered by Dr Sutherland, to enhance CSF flow and encourage better CSF clearance of potential excess calcification. At the moment, this is still an area of limited research and knowledge. 
Acknowledgment/Funding Source: The acquisition of the microCT scanner was made possible by a Major Research Instrumentation (MRI) grant from the National Science Foundation (NSF 1828305) to PIs Simone Hoffmann, Julia Molnar, Azhar Ilyas, Olga Savinova, and Claude Gagna and with the support of NYIT's College of Osteopathic Medicine (NYITCOM), College of Engineering and Computing Sciences, and College of Arts and Sciences. We thank Kelsi Hurdle for technical assistance with microCT data collection. 
References
1. Bordoni, B., Morabito B., Simonelli M., (2019). Cranial Osteopathy: Obscurantism and Enlightement. Cureus. 11(5). 
2. Geschwind, D. H., Loginov, M., Stern, J. M. (2002). Identification of a Locus on Chromosome 14q for Idiopathic Basal Ganglia Calcification (Fahr Disease). American Journal of Human Genetics. 65(3):764-772. 
3. Lauterback, E. C., Psychiatric Management in Neurological Disease. Washington, DC. American Psychiatric Press, 2000. 
4. Lanzer, P. Boehm, M., Sorribas, V., Thiriet, M., (2014). Medical vascular calcification revisited. European Heart Journal. 35(23): 1515-1525. 
5. Mufaddel A. A., (2014). Familial idiopathic basal ganglia calcification (Fahr's disease). Neurosciences Journal. 19(3): 171-177. 
6. Otu, A. A., Anikwe J. C., Cocker D., (2015). Fahr's disease: a rare neurological presentation Clinical Case Reports. 3(10): 806-808. 
7. Sergueef, N., Greeg, M. A., Nelson, K. E., Glonek, T. (2011) palpated cranial rhythmic impulse (CRI) International Journal of Osteopathic Medicine. 14(1): 10-16. 
*B16—Chronic Diseases and Conditions
The Phenotypic Interplay Between the Brain and Skull in Developing Chicken (Gallus Gallus) and American Alligator (Alligator Mississippiensis) 
Mariel Bedell, OMS II1; Watanabe Akinobu, PhD2 
1New York Institute of Technology College of Osteopathic Medicine 
2Department of Anatomy, New York Institute of Technology College of Osteopathic Medicine 
Statement of Significance: The interplay between the brain and skull in development is a complex dynamic underlying congenital diseases and craniofacial evolution. While signaling proteins between the developing brain and skull in chickens have been identified, a structural characterization of this interaction has been elusive. As birds have proportionally large brains comparable to mammals, elucidating their brain-skull integration can facilitate understanding of cranial morphology across vertebrates, including humans. Studying anatomical variation through development can provide insight into causes and effects of abnormal facial morphologies (e.g. craniosynostosis).Through anatomical study, osteopathic methods can be enhanced to diagnose and manage these conditions. 
Methods: This research uses high-resolution X-ray computed tomography (CT) scans of chicken (Gallus gallus) and alligator skulls (Alligator mississippiensis) in several different stages of development. Skulls and brains of the same set of individuals were reconstructed from these CT scans of unstained and iodine-stained specimens respectively. We then virtually placed 3D coordinate points on the skull and brain reconstructions to collect high-density shape data of the brain and skull. In the skull, we quantified the shape of the premaxilla, maxilla, nasal, jugal, frontal, parietal, squamosal, supraoccipital, exoccipital, basioccipital, occipital condyle, quadrate, pterygoid, basipterygoid, palatine, and the palatal side of the premaxilla and maxilla bones. For brain shape data, we characterized the morphology of major developmental and functional regions including the cerebrum, optic lobe, medulla, and cerebellum. 
Data Analysis: We employed geometric morphometric methods (multivariate statistical shape analysis) to test how the brain, skull, and their major regions covary during development. Data processing and analysis was conducted using R programming language. Overall brain-skull correlation was evaluated, modeled, and visualized using two-block partial least squares analysis. In addition, the covariation patterns were analyzed for each major subdivision of the brain to assess how and to what degree brain regions are strongly associated with skull development. These patterns of developmental integration in chickens were compared with those of alligators to assess evolutionary relationships. 
Results: Two-block partial least squares analysis on brain and skull shapes in developing chickens shows that they are statistically significantly correlated, where brain morphology is strongly correlated with the anterior part of the skull, including the beak. The strongest correlations between the brain and skull in chickens were observed for the cerebrum (r-PLS=0.961, P=.01), as well as for the optic lobe (r-PLS=0.908, P=.016). Analysis of alligators did not show significant integration between the skull and brain regions. Finally, when compared with our earlier study, the developmental association between the brain and skull in chickens mirrors the evolutionary pattern of how brain shape correlates with skull shape across the avian tree of life. 
Conclusion: Results from two-block partial least squares analysis on chickens indicate that the cerebrum and the optic lobe have significant influences on skull development, particularly in the anterior region. This result agrees with known molecular signaling pathways that originate from the cerebrum and reach the surrounding skull elements. In the alligator, strong and statistically significant correlations were not observed when studying the interplay between the skull and the brain as a whole, as well as with individual brain regions. Comparing with the chicken specimens, these results suggest that the developmental interplay between the skull and brain is clearly distinct between these 2 groups. This may be due to the highly accelerated development in birds that promotes stronger interplay between the brain and skull. In particular, enlarged cerebrum and optic lobes are hallmarks of the avian brain and their faster growth could be the reason for their stronger influences on skull development compared with the cerebellum and medulla. 
Acknowledgment/Funding Source: We thank Ruth Elsey (Rockefeller Wildlife Refuge), Gregory Erickson (FSU), Broderick Vaughan (Vaughan Gators), Doug Warner (Charles River Lab), Morgan Hill and Henry Towbin (AMNH). This study was funded by the National Science Foundation Graduate Research Fellowship, Mary R. Dawson Predoctoral Fellowship Grant through the Society of Vertebrate Paleontology, Jurassic Foundation, Richard Gilder Graduate School, the Division of Paleontology at the AMNH, and the NYITCOM Summer Research Program. 
References
1. Adams, D. C., and Otárola-Castillo, E. (2013). Geomorph: an R package for the collection and analysis of geometric morphometric shape data. Methods in Ecology and Evolution 2013: 393-399. 
2. Adams, D. C., Collyer, M. L. (2016). On the comparison of the strength of morphological integration across morphometric datasets. Evolution 70: 2623-2631. 
3. Felice, R. N., Goswami, A. (2018). Developmental origins of mosaic evolution in the avian cranium. Proceedings of the National Academy of Sciences 115: 555-560. 
4. Gold, M. E. L., Watanabe, A. (2018). Flightless birds are not neuroanatomical analogs of non-avian dinosaurs. BMC Evolutionary Biology 18: 190. 
5. Northcutt, R. G. 2002. Understanding vertebrate brain evolution. Integrative and Comparative Biology 42:742-756. 
6. R Core Team. (2019). R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing, Vienna, Austria. http://www.R-project.org/ 
★*B18—Impact of Osteopathic Manipulative Medicine (OMM) & Osteopathic Manipulative Treatment (OMT)
Developing “Migraneous” Rat Models to Evaluate the Efficacy of OMT on Various Migraine Biomarkers 
Katherine Elizabeth Byrd, OMS III1; Caroline Gregory, OMS II2; Sharma Krishna, 3; Jennifer Xie, PhD2; Regina Fleming, DO4 
1New York Institute of Technology College of Medicine at Arkansas State University 
2Department of Basic Sciences, New York Institute of Technology College of Osteopathic Medicine at Arkansas State University 
3Department of Biological Sciences and Arkansas Biosciences Institute, New York Institute of Technology College of Osteopathic Medicine at Arkansas State University 
4Department of Osteopathic Manipulative Medicine, New York Institute of Technology College of Osteopathic Medicine at Arkansas State University 
Statement of Significance: Migraine is a disabling disorder characterized by recurrent unilateral throbbing cephalic pain often associated with hypersensitivity to a variety of external stimuli including light and sound. Initiating events remain unknown, although the ultimate activation of the trigeminovascular system is considered to be essential for pain. Current pharmacologic treatments, both abortive and prophylactic, for migraine headache have been shown to be inadequate for many patients due to lack of efficacy or intolerable side effects. This brings the focus to providing noninvasive therapies such as osteopathic manipulative treatment (OMT) to reduce migraine frequency and intensity. 
Methods: Our first model examines the efficacy of OMT through the lens of the cephalic pain often experienced during migraines. We used adult female Sprague-Dawley rats to limit sex differences and reflect the gender susceptibilities in humans (female:male migraineurs ratio 2:1). Migraines were induced using a “double-hit” strategy starting with bilateral injections of Complete Freund Adjuvant (CFA, 10 ul/injection, 5 injections/side) to the trapezius muscle on D1. CFA produced mild inflammation. However, the periorbital tactile threshold remained normal. On D8, umbellulone (50 mM/50 ul), a migraine trigger from the “headache tree”, was introduced to awake rats via inhalation for 30 min at 2 L/min O2. Soft tissue technique (STT), an OMT commonly used to manage migraines, was adapted to this rat model and compared with sham treatments. STT was applied at the dorsal aspect of the neck for 2 min under isoflurane anesthesia at D2 and 4 postCFA. A final treatment was applied at D8 after umbellulone exposure. Periorbital tactile threshold was assessed prior to CFA administration and for 5 h following umbellulone using calibrated von Frey filaments (cut off 8 g). We are now working on a new behavioral testing method examining voluntary wheel-running activities for 5h following umbellulone inhalation using customized running-wheel cages in order to examine OMTs efficacy in migraneurs return to normal physical activities. Described procedures were in line with accepted IACUC protocol. 
Data Analysis: Prism was used for data analysis. Mean or median and SEM are reported. P<.05 was considered statistically significant. For the periorbital threshold, 2-way ANOVA post hoc Dunnett multiple comparison test was performed to compare OMT vs SHAM treatment on CFA-primed “migrainous” rats and CFA-primed rats that received the vehicle. Initial analysis revealed significant interaction among all groups [F(5,82)=2.953, P=.017]. Posthoc analysis revealed a significant difference in periorbital allodynia in 2-5h testing in groups who received OMT vs Groups who received the SHAM treatment with those receiving a sham treatment with the greatest mean difference occurring in hour 5 with a mean difference of 3.259 [CI95 (1.43, 5,09), P=<.0001) with an adjusted P value of .05 for all 5 hours. The percent change in voluntary running wheel data for both umbellulone and vehicle groups was analyzed using the Mann-Whitney Test. A Mann Whitney test indicated that the vehicle group (n=4) had greater levels of activity (Mdn=24.37) than the umbellulone group (n=4, Mdn =-61.43), U= 0, P=.014. Umbellulone group (n=4) had a mean drop in activity of -57.37±16.7%, while the vehicle group displayed a mean increase in the activity of 117.86±101.5%. 
Results: The results showed that umbellulone successfully induced cephalic allodynia at 2-5 h postdose selectively in CFA-primed rats, which was effectively mitigated by STT (P<.05 compared with the sham treatment). At this point in time, we have also been able to demonstrate a significant decrease (∼ 57%) in voluntary wheel-running activity in rats exposed to umbellulone with previous trapezial injections of CFA 
Conclusion: The data from the cephalic allodynia model imply that OMT may function as an effective treatment for the headache and neck pains experienced during migraines. The initial running wheel model demonstrates a drop in physical activities after undergoing our "double-hit" strategy with Complete Freund Adjuvant and umbellulone. Our next step is to determine whether OMT could restore the physical activities in “migraineous” rats. We will attempt to do OMT in awake animals to eliminate the potential interference of the isoflourane. Further studies could further determine the optimal amount of OMT necessary to provide sufficient pain relief as well as OMT's effects on other biomarkers of migraine such as plasma CRGP levels. 
References
1. Goadsby, P. J. Pathophysiology of migraine. Neurol Clin 27, 335-360, doi:S0733-8619(08)00171-0 [pii] 10.1016/j.ncl.2008.11.012 (2009). 
2. Hawkins, J. L., Cornelison, L. E., Blankenship, B. A. Durham, P. L. Vagus nerve stimulation inhibits trigeminal nociception in a rodent model of episodic migraine. Pain Reports in press (2017). 
3. Espi-Lopez, G. V. et al. Effect of Soft Tissue Techniques on Headache Impact, Disability, and Quality of Life in Migraine Sufferers: A Pilot Study. J Altern Complement Med 24, 1099-1107, doi:10.1089/acm.2018.0048 (2018). 
4. Biondi, D. M. Cervicogenic headache: a review of diagnostic and treatment strategies. J Am Osteopath Assoc 105, 16S-22S (2005). 
5. Nassini, R. et al. The ‘headache tree’ via umbellulone and TRPA1 activates the trigeminovascular system. Brain 135, 376-390, doi:10.1093/brain/awr272 (2012). 
6. Blau, J. N. MacGregor, E. A. Migraine and the neck. Headache 34, 88-90 (1994). 
*B19—Chronic Diseases and Conditions
Pseudolaric Acid B (Pab) Induces Senescence by Activation of p53/p21 Pathway in Pancreatic Cancer Cells 
Brandon Hamm, OMS II1; Kartick C. Pramanik, PhD2 
1University of Pikeville Kentucky College of Osteopathic Medicine 
2Department of Basic Sciences, University of Pikeville, Kentucky College of Osteopathic Medicine (KYCOM) 
Statement of Significance: The significance of this study is that once it is understood how PAB mediated activation of p53 induces senescence, the insight gain will help us to develop a way to prevent pancreatic cancer by using strategy with PAB alone or combination with another chemotherapy. Osteopathically, understanding the causes and consequences of cellular senescence provides us a novel therapy for the chronic management of pancreatic cancer. This knowledge will help physicians to approach patients holistically to maintain a quality and quantity of life. 
Research Methods: PANC-1 cell line was used to test this hypothesis. 
Senescence-Associated β-Galactosidase (SA-β-Gal) staining: Senescent cells were detected using SA-β-Gal staining method. Cells were treated with 0.5, 1 μmol/L PAB for 24, 48, 72, 96h. The senescent cells were identified as the blue-stained cells using a light microscope. Analysis of cell cycle by flow cytometry: PAB treated cells were collected and fixed in 70% ethanol overnight. After washed with PBS, cells were stained with propidium iodide solution. Cell cycle distribution was analyzed by Novocyte flow cytometer. Observation of Morphological Changes: Cells were treated with 0.5 and 1 μmol/L PAB for indicated time periods and observed using phase contrast microscope. Next, the cells were stained with 300 ηmol/L 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI) to see the changes in the nuclear morphology under a fluorescence microscope. Transfection of siRNA: The cells were transfected with control-siRNA, p21, or p53 siRNA-Mate using Lipofectamine 3000 transfection kit (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. Transfected cells were treated with 0.5 and 1 μmol/L PAB for indicated times. Western Blot Analysis: Expression of proteins were detected by western blot method. Cell lysate from various experiments containing 10-80 mg protein was resolved by 6-12.5% SDS-PAGE. Expression of p-P53, p-53, Cl-PARP, Cyclin B1, p-Histone H3, Actin will be found by using enhanced chemiluminescence kit. 
Data Analysis: All experiments were conducted at least 3 times independently. Statistical significance differences will be determined by One-Way ANOVA and t test. *P < 0.05 is considered as significant. 
Results: In this project, we evaluated the effect of PAB in induction of senescence in pancreatic cancer cells. Our results show that 0.5 and 1 μmol/L of PAB treatment induces senescence at 48- and 72-hours by evidence of positive SA-β-Gal staining when compared with control. Our results also suggested that PAB at 0.5 µM for 72h treatment induced senescence more than 1µM treatment. Senescence is described as irreversible growth arrest. To determine PAB mediated cell cycle arrest, cells were treated with PAB for 48h and 72h. Our results show that PAB treatment causes G2/M cell cycle arrest in a concentration dependent manner. The appearance of enlarged, flattened, adherent, and multinucleated cells is indicative of senescence. To test that, cells were incubated with DAPI staining. Our results also show that, PAB treatment (0.5µM and 1µM for 48 and 72h) showed enlargement, flattening, and multinucleated cells. 
p53 plays an important role in PAB induced senescence. Our previous results suggested that PAB treatment increases the expression of protein levels of p53, phosphorylates of p-53 and cleavage of PARP (hallmark for apoptosis). In this project, we expect that PAB mediated induction of senescence by activation of p53/p21 pathway. We also expect that PAB treatment could upregulate Cyclin B1, an established marker of the G2/M phase and Histone H3, which can play role in mitotic chromosome condensation. 
Conclusion: PAB treatment has shown to induce senescence in pancreatic cancer cells by evidence of increased SA-β-Gal staining. Further, PAB treatment causes G2/M cell cycle arrest. We expect that PAB mediated induction of senescence by activation of p53/p21 pathway. 
Acknowledgement/Funding Source: The study was supported by UP-KYCOM Summer Research Fellowship awarded to Brandon Hamm and KYCOM internal grant awarded to Dr. Pramanik. 
B20—Chronic Diseases and Conditions
Investigation of a Potential Therapy for Cerebellar Ataxia: transcranial Alternating Current Stimulation (tACS) Using an in Vivo Approach 
Rachel Erin Davis, OMS II1; Rebecca A. Heffner, OMS II1; Francis H. Anderson, OMS II1; Timothy R. Cofer, OMS II1; Huo Lu, PhD2 
1Philadelphia College of Osteopathic Medicine (Georgia Campus) 
2Department of Biomedical Sciences, Philadelphia College of Osteopathic Medicine (Georgia Campus) 
Statement of Significance: One of the tenets of osteopathic medicine encompasses the belief that the treatment of patients should be based on an understanding of the interrelationship of structure and function. Our study explores one facet of the mechanisms behind tES, which has been suggested as a potential therapy for cerebellar ataxia. By investigating the functional effects of tES on Purkinje cell firing rate with subsequent effect on the motor cortex, this can be used to better understand tES as a beneficial treatment for individuals with cerebellar ataxia. 
Methods: All cranial surgical procedures were performed according to the Bower laboratory methods (Bower et al. 1981). Protocols used in this project have been approved by the IACUC (#A18-005) of PCOM. Fourteen adult Sprague-Dawley rats were used in this study. The rats were sedated in an induction chamber using isoflurane followed by an injection of Ketamine/ Xylazine/ Acepromazine cocktail. Supplemental injections were administered throughout the experiment to maintain anesthesia, if pedal reflex was present. Vital signs and temperature were monitored throughout the experiment to ensure the health of the animal. The animal was then placed on a stereotaxic apparatus, and surgery was performed to expose the surfaces of the cerebellar and contralateral motor cortices to allow the use of recording electrodes. The ground electrode was placed in the cheek, and a metal wire was positioned on the skin immediately posterior to the hole prepared over the cerebellum to deliver stimulation. An alternating current (100, 200, or 400 μA) was delivered using stimulus isolator for 20 minutes at 20 Hz. Neural recordings were collected in 3 segments: before stimulation (10 min control), during stimulation (20 min), and after stimulation (10 min). Data were then analyzed using MATLAB. 
Data Analysis: Data analyses were performed using a mathematical software program, MATLAB. Data were filtered between 1-10,000 Hz. Average firing rates of the Purkinje cells were calculated to determine the change between pre- and poststimulation to study the direct effect from the stimulation. For each data set, a power spectrum plot was generated to display dominant frequency changes of local field potential (LFP) recorded from the cerebellar and motor cortices before, during, and after stimulation. Plots demonstrating cross-correlation and coherence between cerebellar and motor cortical activity were also generated for recordings from before and after stimulation for each set of data. This data analysis is to explore the consequent effects following cerebello-thalamo-cortical pathway. 
Results: The results of the power spectrum analysis under 200 μA stimulation revealed that tACS decreases the peak amplitude at low-frequency (2 Hz) while the motor cortex remains unchanged. This decrease was observed in 8/10 recordings. For recordings done under 100 uA stimulation similar results were seen in 4/7 cells, while 2 cells showed an increase at 2 Hz, and 1 cell showed no change. The cross correlation level between cerebellar and cerebral cortical LFPs under 100 μA demonstrated an increase in 4/8 recordings. Two of the recordings showed a decrease. and 2 recordings were unchanged. Nine recordings showed coherence between the 2 brain regions at 10 Hz, 5/9 displayed either an increase or decrease. Eight out of 9 recordings showed additional coherence from 85 to 95 Hz. The cross correlation level between cerebellum and cerebral LFPs under 200 μA demonstrated an increase in 4/7 recordings, while 1 decreased, and 2 were unchanged. 5 recordings showed coherence between the 2 brain regions at 10 Hz, with all 5 displaying either an increase or decrease. In order to study the response of individual PCs to tACS, we successfully isolated 9 PCs from the cerebellar cortex. Six of these cells demonstrated a decrease in the average firing rate between pre- and poststimulation (11.6 Hz), while 3 cells demonstrated a slight increase (1.6 Hz). 
Conclusion: Firing rate was demonstrated to decrease after tACS indicating that the activity of the Purkinje cell was decreased poststimulation. The findings from this study suggest that tACS can induce a change in cerebellar cortical activity at low-frequency. Subsequent changes in the motor cortex, at the same low-frequency, were observed but not as strongly. This is supported by power spectrum analysis conducted to study the changes in cerebellar cortical activity results from this analysis showed a decrease in peak amplitude at a low frequency (approximately 2 Hz) in 12/17 cells. The cross correlation between the cerebellum and cerebral LFPs demonstrated an increase, indicating that tACS altered the communication between the cerebellar and motor cortices. Coherence changes were observed at low-frequency, 10 Hz, which indicates that tACS synchronizes cerebellar and cerebral cortical activities at a preferred frequency. 
Acknowledgment/Funding Source: We would like to thank Dr Huo Lu and Ms. Shaunda Bell for their excellent technique assistance and training at GA-PCOM campus animal facility. 
References
1. Bower JM, Beermann DH, Gibson JM, Shambes GM, Welker W (1981) Principles of organization of a cerebro-cerebellar circuit. Micromapping the projections from cerebral (SI) to cerebellar (granule cell layer) tactile areas of rats. Brain Behav Evol 18:1-18. 
*B21—Chronic Diseases and Conditions
Study of Purkinje Cell Response to Alternating Current Stimulation (ACS) as a Treatment Modality for Cerebellar Ataxia: An in Vitro Approach 
Silvia Cherian, OMS II1; Hye Rhee Chi, OMS II1; Marc Eli Faldas, OMS II1; Huo Lu, PhD2 
1Philadelphia College of Osteopathic Medicine (Georgia Campus) 
2Department of Biomedical Sciences, Philadelphia College of Osteopathic Medicine (Georgia Campus) 
Statement of Significance: The osteopathic significance of this research is to understand the cellular effects of ACS on firing rate of Purkinje cells to further our understanding of the mechanism of ACS as a potential therapy for cerebellar ataxia. Transcranial current stimulation is a non-invasive therapy designed to deliver an electric current through the brain to improve symptoms of cerebellar ataxia (Pilloni, 2019). In vitro research will assist in the optimization of ACS therapy for patients with cerebellar ataxia. 
Methods: This study follows the protocol (#A17-009) approved by the PCOM IACUC. Sprague-Dawley (SD) rats were used for all experiments. Young pups were used to maximize the quality of recording. Each rat was placed in an induction chamber with isoflurane for 2-4 minutes. Rats were then weighed and decapitated using a guillotine. An incision was made along the midline of the dermis using surgical scissors. Excess cervical muscles and fascia at the base of the skull was excised. The parietal bone was then removed and the cerebellum was cut with a scalpel. Vessels and meninges were removed from the specimen and placed in ice-cold artificial cerebrospinal fluid (ACSF) before being staged onto the vibratome loading block. Parasagittal sections of 200-300 μm in thickness were obtained. Slices were then incubated in a 37 degree Centigrade chamber. In vitro recordings of Purkinje cells were obtained using whole-cell patch-clamp and Axoclamp-200B amplifier. A ground electrode and a glass pipette filled with internal solution was used to patch the cell prior to applying ACS (20 Hz). Pre-, during- and poststimulation recordings were obtained. While establishing a membrane potential to between -60 mV and -75 mV with bias current, a series of current commands (-0.5 nA to +0.5 nA at 0.1 nA per step) were given to test the basic properties of the cell under the control condition. In addition, spontaneous activity was recorded without bias current. 
Data Analysis: Statistical significance was determined via Student t test. Frequency plots to present a visual representation of the changes in firing pattern was processed using a mathematical computer software program, MATLAB. Traces from pre-, during- and poststimulation were processed with the number of spikes with the best trace. Corresponding frequency plots were generated to analyze changes in firing rates. 
Results: Thirteen Purkinje cells were recorded. When comparing the firing rate during the basic property test, before and after applying stimulation, there was a notable decrease in the average firing rate (5.46%, P=.00079). However, there were no increase in average firing rate when ACS was administered. Spontaneous activity of 8 cells pre, during, and after stimulation was recorded. 5 cells showed more than 5 Hz decrease in average firing rate.One cell showed no change throughout all 3 stages. The remaining 2 cells increased its average firing rate. Overall, the frequency of spontaneous firing decreased (5 Hz) after the administration of ACS. 
Conclusion: The firing rate of Purkinje cells (8 out of 12) decreased after administering ACS. It is important to consider the fact that Purkinje cells communicate within a circuit of excitatory and inhibitory cells. Therefore, the data obtained from stimulating a single-unit Purkinje cell describes how cells perceive and respond to ACS. This confirms that alternating current stimulation has potential to modulate the Purkinje cell's firing pattern despite the change in observable firing rate only to be minor. This change did not include the test on the intensity of stimulation. In the future, we will pay more attention to the intensity dependence together with orientation of the Purkinje cells. 
Acknowledgment/Funding Source: We thank Dr Huo Lu and Ms. Shaunda Bell for their excellent technique assistance and training at PCOM-GA campus animal facility. 
References
1. Pilloni, G., Shaw, M., Feinberg, C., Clayton, A., Palmeri, M., Datta, A., and Charvet, L. E. (2019). Long term at-home treatment with transcranial direct current stimulation (tDCS) improves symptoms of cerebellar ataxia: a case report. Journal Of Neuroengineering And Rehabilitation, 16(1), 41. https://doi.org/10.1186/s12984-019-0514-z 
*B22—Chronic Diseases and Conditions
Chronic Inflammation Negatively Alters the Cellular Components of the Myofascia 
Chante Richardson, PhD; Christina Kennedy, PhD 
Alabama College of Osteopathic Medicine 
Statement of Significance: MP affects approximately 8 percent of the US population. Clinically, MP is difficult to diagnose and treat because of the numerous etiologies. As a result, a subset of patients with MP due to chronic inflammatory continue to suffer due to the lack of understanding the effects of inflammatory mediators on the myofascial tissue. The osteopathic diagnosis and treatment algorithm, specifically the myofascial release technique, confirms both the clinical relevance and scientific value in the complex interactions of the fascia and muscle. (2) Our study seeks to elucidate the structural and functional changes that occur in the myofascia when exposed to chronic inflammatory stimuli, TNF-alpha. 
Research Methods: Fibroblasts, the predominant cell type in the fascia, make the extracellular matrix and collagen, which form the structural scaffold in tissue and play an important role in wound repair. (3) Fibroblasts respond to biomechanical stimuli such strain tension by secreting cytokines, which contribute to cellular changes. Previous studies show that the proinflammatory cytokine tumor necrosis factor-alpha (TNF-alpha) has catabolic effects on tissue function (4) and is directly involved in the loss of skeletal muscle mass and function. Structure and function of skeletal muscle is inextricably linked to that of the fascia. Therefore, evaluating the cellular responses of both fibroblasts and skeletal muscle to inflammatory mediators such as TNF-alpha is important. This area of study is limited in the in vitro models that truly mimic the myofascial microenvironment. Many studies utilize murine or human fibroblasts co-cultured with murine skeletal muscle cells to show that the fascia and skeletal muscle reciprocally induce structural and functional changes in each other through physical contact and paracrine signaling, although the exact mechanism has not been determined. To assess the molecular mechanisms, we examined the direct effects of the inflammatory stimuli TNF-alpha on human skeletal muscle (HSkM) cells and human dermal fibroblasts structure and function individually. 
Data Analysis: Each cell type in isolation was exposed to various concentrations of recombinant human TNF-alpha (0.025 µg/µL, 0.050 µg/µL , 0.10 µg/µL, 0.20µg/µL) for 5 days in cell culture. All cell culture experiments utilized 0.35 - 0.50 million cells/experiment. Cells were cultured in a humidified incubator maintained at 37 degrees, 5% carbon dioxide and 100% humidity. Cells were fed every 2 days with fresh media and passaged when 80-90% confluent. Cell quantification, cell viability, and light microscopy were used to evaluate the cellular growth and morphologic changes. Cell were quantified on day 5 using Nexlecom cell counter and trypan blue. Light microscopy images were taken with a 10X objective on day 5. Human transforming growth factor beta (TGF beta) and human Pro Collagen 1a enzyme-linked immunosorbent assay (ELISA) kits were used to quantify the amount produced by the HSkM cells and fibroblasts respectively. Each experiment was done in technical and experimental triplicates. All results were analyzed by performing unpaired 2-tailed t tests or 1-way analysis of variance (ANOVA) with Tukey post-hoc tests when comparing multiple groups. P-values less than or equal to 0.05 was considered significant. 
Results: Based on our results, we can conclude that HSkM cells and human fibroblasts respond to TNF-alpha in a similar fashion as they do to muscle injury. We found that exposure to TNF-alpha causes HSkM cells and human fibroblasts to exhibit opposite responses to inflammation. That is, HSkM cells experienced a decrease in cell growth, while fibroblasts experienced an increase in cell growth when exposed to increasing TNF-alpha concentrations. We also show that the inflammatory stimuli, TNF-alpha, visually changes cell-cell interaction and cell growth of HSkM cells and fibroblasts. Next, we assessed the function of these 2 cells types looking at TGF-beta production and Pro-Collagen Ia. In skeletal muscle, TGF-beta regulates extracellular matrix remodeling and stimulates fibrosis. Muscle biopsies from patients with chronic inflammatory disease show increased TGF-beta expression in the extracellular matrix and in fibrotic tissue. Our data reveals that when we exposed the HSkM cells to TNF-alpha there is a statistically significant increase in TGF-beta production suggesting that exposure to inflammation leads to the formation of fibrotic tissue. We are currently assessing the Pro-Collagen 1a production in the fibroblasts exposed to TNF-alpha. 
Conclusion: Collectively, our results supports our hypothesis that the structure and function of the myofascial tissue changes under chronic inflammatory conditions. By understanding how the major cellular components of the myofascia respond to inflammation in isolation provides the foundation for understanding how they interact in their normal microenvironment. We have begun to develop a direct contact co-culture in vitro model of the myofascial tissue to mimic the microenvironment. Once we have established this model, we can began to assess the interaction and paracrine signaling that occurs between the HSkM cells and human fibroblasts when exposed to the inflammatory mediator, TNF-alpha. This will help to elucidate the molecular mechanism underlying the inflammatory component of myofascial pain and potentially clarify the signaling changes that occur when using OMT technique, myofascial release. 
Acknowledgement/Funding Source: This project has been approved by the Alabama College of Osteopathic Medicine'Institutional Review Board Project approval renewed: 29 January 2019 
Exemption Number: HS190129E 
References
1. Chandola HC, Chakraborty A Fibromyalgia ands myofascial pain syndrome-a dilemma. Indian journal of anaesthesia. 2009;53(5):575-81. PubMed PMID: 20640108 
2. Hicks MR, Cao TV, Campbell DH, Standley PR. Mechanical strain applied to human fibroblasts differentially regulates skeletal myoblast differentiation. Journal of applied physiology (Bethesda, MD:1985). PubMed PMID: 22678963 
3. Meltzer KR, Standley PR. Modeled repetitive motion strain and indirect osteopathic manipulative techniques in regulation of human fibroblast proliferation and interleukin secretion. The Journal of the American Osteopathic Association. 2007;107(12):527-36.PubMed PMID:18178762. 
4. Duncan MR, Berman B. Differential regulation of collagen, glycosaminoglycan, fibronectin, and collagenase activity production in cultured human adult dermal fibroblasts by interleukin 1-alpha and beta and tumor necrosis factor-alpha and beta. The Journal of investigative dermatology. 1989;92(5):699-706 PubMed PMID:2541208 
*B23—Impact of Osteopathic Manipulative Medicine (OMM) and Osteopathic Manipulative Treatment (OMT)
Examining Structural and Functional Relationships to Improve Respiratory Mechanics: Implications for Nebulizer Therapy for COPD, Asthma, and CF 
Ayesha N. Shahid, MBS1; Robert Murphy, MS2; Kurt P. Heinking, DO3; Kyle K. Henderson, PhD4 
1Midwestern University Chicago College of Osteopathic Medicine 
2Department of Physiology, Midwestern University Chicago College of Osteopathic Medicine 
3Department of Osteopathic Manipulative Medicine, Midwestern University Chicago College of Osteopathic Medicine 
4Department of Physiology and Osteopathic Manipulative Medicine, Midwestern University Chicago College of Osteopathic Medicine 
Statement of Significance: Clinical Significance: If standing attenuates restrictive breathing mechanics and increases tidal volume, then nebulizer based drug delivery of corticosteroids, antibiotics, and mucolytics may improve regional targeting of intended gas-exchange regions of the lungs in patients with chronic conditions. This finding further validates the Osteopathic principle that structure and function are interrelated. This benefits the Osteopathic community by emphasizing future Osteopathic studies on postural asymmetry, Osteopathic Manipulative Treatment (OMT), and pulmonary function should include evaluation for a reduction in restrictive mechanics (increased thoracic excursion and tidal volume) in addition to obstructive mechanics (FEV1/FVC ratio). 
Research Methods: Research Method: Midwestern University Institutional Review Board approval was obtained (IRB # 2687) with research participants providing written informed consent. Waist and hip circumferences were measured to correlate to pulmonary function parameters. Upper thoracic, lower thoracic, and abdominal excursions were measured continuously during pulmonary function assessments. Using a crossover design, participants (N=24) recruited from the Midwestern community were selectively randomized to start with a seated forward leaning or standing position. Tidal volume, vital capacity, and forced vital capacity were measured in both positions using spirometry. 
Data Analysis: Data Analysis: Statistical analysis was performed using IBM SPSS Statistics 25. ANOVA with repeated measures were performed with Bonferroni CI adjustments and main effects of postures examined on pulmonary function measures. The alpha value was set to .05. Pearson correlation tests were done for correlations to body habitus and significance was set to P=.05. 
Results: Results: There was a significant increase in tidal volume in the standing position (P<.001). The primary mechanism for the increase in tidal volume was an increase in upper (P<.001) and lower thoracic excursions (P<.001). Interestingly, abdominal excursion was significantly reduced in the standing position (P<.001); possibly due to contraction of abdominal musculature for postural stability. The FEV1, FVC, and FEV1/FVC ratio did not significantly change with posture (P=.913, P=.208, P=.488, respectively). 
Conclusion: Conclusion: These data suggest: 1) Tidal volume increases in the standing position, 2) changes in posture (structure) have a functional effect on respiratory mechanics during tidal breathing, and 3) the changes in respiratory parameters are due to a reduction in restrictive mechanics (thoracic excursion) and not obstructive mechanics (FEV1/FVC ratio). Clinically, nebulizer therapy in the outpatient setting could be augmented in COPD, asthma, and cystic fibrosis patients capable of standing during therapy by increasing tidal volume and drug delivery to distal regions of the lung. Educationally, these data highlight that intervention studies investigating postural asymmetry and/or OMT effects on pulmonary function should include/correlate mechanisms with restrictive and obstructive mechanics. 
Acknowledgement/Funding Source: Acknowledgment: These studies were supported by financial support from the Department of Osteopathic Manipulative Medicine, the Chicago College of Osteopathic Medicine, and the College of Graduate Studies at Midwestern University. 
*B25—Chronic Diseases and Conditions
Effects of Quaternary Ammonium Compound Exposure on Neuronal Protein Kinase A Expression 
Anna Saldanha, OMS III1; Chad E. Byrd, OSM IV1; Terry C. Hrubec, DVM, PhD2 
1Edward Via College of Osteopathic Medicine (Virginia) 
2Department of Biomedical Sciences, Edward Via College of Osteopathic Medicine (Virginia) VA-MD College of Veterinary Medicine 
Statement of Significance: QACs are disinfectants included in commercial cleaning and personal care products such as detergents and hand soaps. With such a wide breadth of use and thus a high rate of exposure, there is increased concern for the potential consequences to peoples’ health. Previously noted acute health consequences in humans include contact dermatitis, asthma, and ingestion injuries. In mice, tachypnea and dyspnea, resulting in cyanosis, and decreased activity with ataxia and kyphotic posturing were noted. Chronic toxicity in humans is not well described. In mice, chronic exposure to alkyldimethylbenzyl ammonium chloride (ADBAC) and didecyldimethyl ammonium chloride (DDAC), 2 specific QAC compounds, caused developmental toxicity manifested as NTDs. 
Research Methods: Mothers, also known as dams, in the treatment group received exposure to ADBAC+DDAC disinfectant for 2 weeks and throughout breeding until gestation day 17; mothers in the control group were bred and carried to gestational day 17 in a QAC-free environment. On gestational day 17, both dams and fetuses were euthanized. The fetal heads were removed, snap frozen, and then cryosectioned. Immunohistochemistry was used to localize PKA within the brain. Control brains, exposed brains and negative controls for both were run simultaneously. 
Data Analysis: Stained sections were visualized using microscopy. The different regions were compared between the control group and exposed groups to visualize differences in staining. 
Results: In both of the exposed and control groups, regions of the brain stained differentially allowing identification of brain region and section level. In control brains, a darker area of staining was visualized in the diencephalic region. This staining was not seen in the QAC exposed brains. No staining was visualized in the negative controls confirming these results were not due to non-specific binding of the antibody. 
Conclusion: During development the diencephalon later differentiates into the thalamus, a cortical relay center in the brain, via Shh regulation. The thalamus in mice exhibit conserved organization and function, comparable to that in humans, including perception, movement, and cognition. By looking at the regionalization of PKA, we can develop a greater understanding of the developmentally toxic effect of QAC exposure in the developing brain and identify a potential mechanism for QAC-induced NTDs. 
Acknowledgement/Funding Source: This work was supported by VCOM-VMCVM One Health Program. 
References
1. Briassoulis, G., Keil, M. F., Naved, B., Liu, S., Starost, M. F., Nesterova, M., Gokarn, N., Batistatos, A., Wu, T. J., … Stratakis, C. A. (2016). Studies of mice with cyclic AMP-dependent protein kinase (PKA) defects reveal the critical role of PKA's catalytic subunits in anxiety. Behavioural brain research, 307, 1-10. 
2. Hrubec, T. C., Melin, V. E., Shea, C. S., Fergusion, E. E., Garofola, C., Repine, C. M., … Hunt, P. A. (2017). Ambient and dosed exposure to quaternary ammonium disinfectants causes neural tube defects in rodents. Birth Defects Research, 109,1166-1178. doi:10.1002/bdr2.1064 
3. Huang, Y. A., Kao, J. W., Tseng, D. T., Chen, W. S., Chiang, M. H., & Hwang, E. (2013). Microtubule-associated type II protein kinase A is important for neurite elongation. PloS one, 8(8), e73890. doi:10.1371/journal.pone.0073890 
4. MacDonald, V. A. (2017). Evaluating immunotoxicity of quaternary ammonium compounds (Master's Thesis). Retrieved from Virginia Tech Database. 
*B26—Chronic Diseases and Conditions
Echocardiographic and Vascular Ultrasound Study of Mice With Chronic Kidney Disease and Hyperphosphatemia 
Vishva Shah, OMS II; Hong Dan, OMS II; Paul Kevin, OMS II 
New York Institute of Technology College of Osteopathic Medicine 
Statement of Significance: Since the body is a unit, CKD not only affects the kidneys but other organs as well, including the heart. Reduced glomerular filtration rate and proteinuria are independently associated with an increased risk for cardiovascular events. Arterial calcification is prevalent in CKD patients and leads to reduced compliance of arterial walls and hypertension. Hyperphosphatemia also promotes vascular arterial calcification and is a strong predictor of cardiovascular mortality. Left ventricular hypertrophy can develop from this, leading to heart failure. CKD patients should be regularly checked for the presence of heart disease. Osteopathic techniques—such as lymphatic pump and myofascial release—can help alleviate and manage these diseases. 
Methods: Mice models do not totally replicate human diseases, but they are beneficial in developing therapeutics that could serve as potential treatments for patients with CKD. 
CKD was induced in 10 week-old mice (50% females) by feeding a nephrotoxic 0.2% adenine-containing diet for 4 weeks (V1). This was followed by a continuation of a nephrotoxic diet (0.2% adenine) or adenine supplemented with phosphate (0.2% adenine and 1.8% dietary phosphate) for another 4 weeks (V2). The standard mouse diet in this study contained 0.8% phosphate. Then, we reported an interim analysis of the study. 18 female and 17 males are enrolled at this time. 
Metabolic, ultrasound, and blood pressure studies were performed at baseline (V0) and upon completion of V1 and V2. Metabolic studies consisted of 24 hour measurements of food and water consumption, along with feces and urine outputs using metabolic cages (Tecniplast). Blood pressure was measured via a tail cuff system (Kent Scientific). A Vevo 3100 ultrasound instrument (VisualSonics) equipped with MX550D transducer (25-55 MHz, Axial Resolution 40 μm) was used for echocardiographic and vascular measurements. Mice were anesthetized with 0.8-1.5% isoflurane and a mid-left ventricular short axis view at the level of papillary muscles was obtained in B-mode and recorded in M-mode. The longitudinal and short axis of suprarenal abdominal aorta, as well as Doppler flow measurements were obtained via a left lateral window. 
Data Analysis: Data were analyzed using GraphPad Prism 8 software. Mean and SDs were calculated. Multiple groups were compared by the ANOVA or Kruskal-Wallis tests for parametric and non-parametric variables as appropriate. 2 groups were compared with each other by the t test or a non-parametric Mann Whitney test. Significance was accepted at P<.05. 
Results: Differences were noted between sexes at baseline (V0): compared with females, male mice had higher body weights (BW), heart rates (HR), smaller adjusted left ventricular (LV) internal diameters (LVID/BW), stroke volumes (SV/BW), and LV mass (LVmass/BW). 
After the induction of CKD (0.2% adenine for 4 weeks, V1), a significantly higher mortality was observed in male mice. Both sexes had increased water consumption and 24h urine output, the latter being more severe in males. Females developed hypertension, whereas some males had hypertension and others hypotension. Compared with baseline, V1 males showed reduced BW and HR, dilated LV and increased end diastolic volume, reduced ejection fraction (EF), and a drop in peak aortic velocity. Aortic elastic modulus and pulse propagation velocity (calculated by pixel tracking from high resolution time resolved images of the abdominal aorta) were increased in both sexes in comparison to baseline. 
A limited number of male mice (2 per group) reached the hyperphosphatemia endpoint (V2). Therefore, the interim analysis presented here is limited to female mice (n=6 in the adenine group and n=4 in the adenine/phosphate group). Compared with the adenine group, adenine/phosphate females displayed increased aortic stiffness manifested as increased elastic modulus and the pulse propagation velocity. 
Conclusion: Adenine containing diet is a reliable method of inducing CKD in mice. Both males and females develop aortic stiffness that can be detected in vivo by high resolution ultrasound. Male mice are more susceptible to cardiac pathology associated with kidney disease. Dietary phosphate further exacerbates aortic stiffness in CKD mice. 
Using high resolution, ultrasound was a useful methodology in measuring different parameters that were able to show the progression of cardiovascular disease in small animal models of CKD. 
Acknowledgment/Funding Source: This work was supported by the National Institutes of Health (NIH) grant number R56 HL131547-01A1 (to OVS). Acquisition of the Vevo 3100 ultrasound instrument for small animal research was made possible by NYIT College of Osteopathic Medicine (NYITCOM). We thank Jeanne Quidore-Jermann and Sandra Kahler for technical assistance. 
★*B27—Chronic Diseases and Conditions
Functional Perturbation of Mustn1 in Cartilage 
Amna Haider, OMS II; Janelle Zapiti, ; Miguel deAnleo, ; Raddy Ramos, PhD; Michael Hadjiargyrou, PhD 
New York Institute of Technology College of Osteopathic Medicine 
Statement of Significance: Identifying the function of the Mustn1 gene in skeletal repair would expand knowledge about the underlying pathophysiology for skeletal diseases. One tenet of osteopathic medicine is that the body has the innate ability to heal itself. Due to the presence of this gene in skeletal development, mutations resulting in loss of gene function may cause deficiencies in bone and healing. In osteopathy, rational treatment is based upon and understanding of the basic principles of body unity, self-regulation, and the interrelationship of structure and function. It is essential to understand the function of this novel gene and its role in the mechanism of cartilage and bone development for the medical treatment potential this knowledge can provide. 
Research Methods: The gold standard to study the function of an unknown gene is through generating knockout mice. The Cre-lox and Flp-FRT system was used to achieve a murine model with a cartilage-specific Mustn1 conditional knockout. In this mechanism, the gene of interest is flanked on either side by loxP sites. Cre recombinase is then used to excise the gene of interest and produce a DNA strand without the gene followed by the Flp-FRT system, which cleans up the gene deletion. Once these mice are crossed, offspring are genotyped to determine whether or not they are Post-Cre and Post-Flp. The genetic map for the Mustn1 gene in cartilage and the appropriate DNA band length values for Post-Cre and Post-Flp genotyping ensure the gene is knocked out. The mice are then divided into those heterozygous and those homozygous for the Mustn1 gene deletion and through subsequent crosses the development of a pure homozygous Mustn1 gene knockout strain is obtained. Successful creation of a conditional cartilage-specific knockout model using the Cre-lox and Flp-FRT technology allows for visualization of the gene's effects on cartilage and overall skeletal development. 
Data Analysis: Since cartilage is predominantly present during embryonic and neonatal development, newborn knockout (KO) mice were selected and compared with age-matched wild-type (WT) mice. Skeletal tissue was harvested, fixed in formalin, paraffin embedded, sectioned by microtome and then stained with Safranin O Fast Green to highlight cartilage for microscopic visualization of chondrocytic density. The intensity of the Safranin O is proportional to the proteoglycan content in the tissue and would aid in comparing cartilaginous properties of the knockout group to the control. Staining was also done using Alcian Blue and Alizarin Red to visualize cartilage and bone morphology. Full-body microCT was also performed to visualize overall structural morphology and quantify differences in bone volume, density, etc. Individual bones from both the KO and WT were isolated and quantified for their properties Using Dragonfly, a visualization software. 
Results: Mustn1 knockout mice were viable in the first generation, and this sustained throughout adulthood where they were able to successfully reproduce. However, in the second generation, all the newborn knockout pups generated died shortly after birth. Suspecting this may be due to parenting, pups were moved to a foster wild-type mother directly after birth and are being monitored. Although, the wild type and knockout mice look very similar, histological staining revealed a qualitative increase of empty space in the in the long bones of the KO as compared with WT mice. Skeletal microCT revealed qualitative structural differences in the KO mice, noticeably the exaggeration of curvature in the spine, but these analyses are continued. Histological analysis and 3D reconstruction of the growth plate in the femur of Mustn1 knockout mice provides a greater understanding of the functional role of the Mustn1 gene in the mammalian skeleton. 
Conclusion: Generation of the mouse model, histological analysis, and 3D reconstruction of the knockout mice provides a greater understanding of Mustn1's functional role in the mammalian skeleton. Further work analyzing the bone mineral density, bone volume, and other parameters via microCT and histology of the mice throughout their growth and development as well as increasing the sample size of the knockout population would provide greater foundation for deeper comparison of the effects of the genetic deletion. Through this comparison, a gene family can be drawn and parallels can be made to genetic conditions of the skeletal system, expanding understanding of skeletal pathophysiology. 
Acknowledgement/Funding Source: 2019 Summer Medical Student Research Fellowship, New York Institute of Technology College of Osteopathic Medicine. 
National Institutes of Health Grant, The Role of Mustn1 in Cartilage Biology. 
Institutional Animal Care and Use Committee (IACUC) approved. 
References
1. Lombardo F., Komatsu D., and Hadjiargyrou M. (2004). Molecular cloning and characterization of Mustang, a novel nuclear protein expressed during skeletal development and regeneration. ​The FASEB Journal. 18:1​, 52-61. 
2. Hadjiargyrou M. (2018). Mustn1: A Developmentally Regulated Pan-Musculoskeletal Cell Marker and Regulatory Gene. ​International journal of molecular sciences,​ ​19(​1), 206. 
*B28—Chronic Diseases and Conditions
Age-related Changes in Cholinergic Activity in the CNS 
Dawid Gerlach, OMS II1; Olivia J. Holodnik, OMS II2; Justin R. Sharp, OMS II2; Joyce Morris-Wiman, PhD2 
1West Virginia School of Osteopathic Medicine 
2Department of Biomedical Sciences, West Virginia School of Osteopathic Medicine 
Statement of Significance: The significance of this research and possible future osteopathic intervention is to better understand the biochemical changes in the hippocampus with aging and targets for future OMT techniques. 
Research Methods: Mouse brains were harvested from young (9-12 months, n=5) and aged (19-24 months, n= 6) BalbC mice, snap-frozen in liquid nitrogen. 14 µm cryosections were mounted consecutively on a series of ten slides to allow comparison of Karnovsky-Root staining for AChE activity and immunostaining. 
Cryosections were immunostained using standard protocols for myelin basic protein (MBP) and neurofilament (NFM), markers for myelin and axonal integrity, NGF, and with ChAT, a cholinergic neuron marker. Digital images of hippocampus and sepal regions were acquired under epifluorescence with a Zeiss MRm digital camera and Axiovision software and then assembled into collages for analysis using Adobe Photoshop. To assess AChE activity, cryosections were stained according to a modified Karnovsky-Root protocol. Digital images of the whole hippocampus and medial septal areas were obtained with a Leica Aperio Versa system. 
Data Analysis: The collages from immunostained sections and digital images of Karnovsky root-stained sections were histogram- matched and thresholded to produce a binary image to eliminate bias and analyzed using Image Pro Plus software. The percentage of the total selected area stained was calculated for 3 representative sections through the hippocampus and septum including anterior, middle and posterior regions. Statistical differences in the distribution of AChE and stained immunomarkers were assessed using Statistica (StatSoft) with significance at p<0.5 by ANOVA, LSD test. 
Results: The aged mouse brains showed significant increases (P<.05) in AChE activity (=P=.003366) in the hippocampus region and NGF expression (=P=.041407) in the septal region. The young mouse brains demonstrated significant increases in NFM expression (=P=.001434) in the hippocampal region as well as increased AChE activity (=P=.042975) in the septal region. No significant differences were observed between young and old mice in hippocampal MBP and ChAT or in septal ChAT expression. 
Conclusion: No difference in ChAT expression was detected, which would indicate no change in cholinergic cell number in normal aging. However, a significant decrease in AChE activity in the septum was observed suggesting a decrease in cholinergic neuronal activity in this region. Results also demonstrated increased NGF expression in the septum in aged mice compared with young. Results from this study showed no significant difference in hippocampal MBP expression between old and young mice. This could indicate that normal aging is not associated with rapid demyelination in this region. There was an observed increase in AChE activity and a decrease in the amount of NFM within the older mouse hippocampus. A decrease in the NFM may indicate the impaired transport of acetylcholine within the hippocampal region. The possible accumulation of unutilized acetylcholine may suggest that the increased activity of AChE within the aged hippocampus detected in this study may be to break down the unused acetylcholine. 
In conclusion, the results of this study suggest that profound demyelination or a decrease in cholinergic neurons are not features of normal aging in the hippocampus or septum. However, normal aging may include alterations in cholinergic function and trophic support of cholinergic neurons within the septum. Future research could analyze other protein content in these areas with Western Blot and Real Time PCR. Limitations of this study include a small sample size. 
Acknowledgement/Funding Source: WVSOM Intramural Research Grant and Summer Research Program. 
B29—Chronic Diseases and Conditions
C Elegans as a Model Organism for Investigating the Relationship Between Uric Acid and Lipid Metabolism 
Kirsten Gateless, OMS II1; Kristie G. Bridges, PhD2; Justin L. Ward, OMS II2; Predrag Krajacic, MD2; Amanda S. Hatcher, BS3 
1West Virginia School of Osteopathic Medicine 
2Department of Biomedical Sciences, West Virginia School of Osteopathic Medicine 
3Academic Lab. Instructor Assistant, West Virginia School of Osteopathic Medicine 
Statement of Significance: Disease prevention is one of the core osteopathic principles. The goal of this project is to provide and validate a model organism that may lead to the development of novel approaches for the prevention and treatment of comorbidities associated with obesity. 
Methods: Wild type and XDH/XO knockout worms were grown at 25°C under standard conditions and fed with Escherichia coli strain Na22 in the presence or absence of allopurinol. Young adult worms were collected by centrifugation. The pellet was resuspended in assay buffer and subjected to 5 freeze-thaw cycles using liquid nitrogen followed by sonication. These steps were needed to lyse the nematode cuticle in the absence of detergents. Lysates were clarified and contaminants removed by centrifugation. Protein concentration of the extracts was determined using the ThermoScientific Coomassie Plus Protein Assay. UA concentration was quantified using the Stanbio LiquiColor assay reagent. Triglyceride concentration was determined using the triglyceride colorimetric assay kit from Cayman Chemical. All assays were done at least 3 times with each data point done in triplicate within experiments. Nile red staining was performed using the Abcam Nile Red Staining Kit (cat# ab228553). Imaging was performed using the Leica Aperio Versa 8 Scanning System at 20x magnification. 
Data Analysis: For all assays, standard curves were generated and used to calculate unknown concentrations. UA and triglyceride levels were corrected for protein concentration. Intra-assay variability (%CV) was calculated for each sample using the triplicate data points within each assay. Inter-assay %CV was calculated using the values from separate experiments. 
Results: Consistent with previous results, UA could be detected in extracts of wild-type nematodes but not in extracts of the XDH/XO knockout. The intra and inter-assay %CV for UA determination were less than 5% and less than 10% respectively. Inclusion of allopurinol in the food lawn decreased UA accumulation in the wild-type nematodes by greater than 20%. Triglyceride levels could be reproducibly detected in extracts from both strains using enzymatic methods. Intra and inter-assay %CV for triglyceride determination were both less than 10%. Lipid accumulation could also be visualized in both strains in the captured images. 
Conclusion: Our results demonstrate that C elegans is responsive to in vivo administration of allopurinol and that triglycerides can be reproducibly measured and visualized in both strains. While additional studies are needed, these are important steps toward validating the use of C elegans as a model organism for investigating the relationship between hyperuricemia and lipid metabolism and storage. 
Acknowledgment/Funding Source: This work was supported by an intramural grant from the West Virginia School of Osteopathic Medicine. 
B30—Chronic Diseases and Conditions
Osteopathy In The Cranial Field As A Method To Enhance Injury Recovery: A Preliminary Study 
Per Gunnar Brolinson, DO1; Natalie A. Hyppolite, DO2; Michelle R. Dickerson, BS3; Susan F. Murphy, PhD3; Pamela J. VandeVord, PhD3 
1Edward Via College of Osteopathic Medicine (Virginia) 
2Department of Osteopathic Manipulative Medicine/Neuromuscular, Edward Via College of Osteopathic Medicine (Virginia) 
3Biomedical Engineering, Virginia Tech 
Statement of Significance: TBI represents a significant clinical burden with over 2 million cases each year. Patients that sustain mild TBI are at greater risk of developing neurodegenerative diseases, such as Alzheimer disease, in addition to experiencing cognitive and psychological deficits. Currently, no therapeutic strategies have proven successful in mitigating the effects of TBI, thus novel strategies must be considered to improve the quality of life of TBI patients. Evidence on the clinical efficacy of OCF is heterogeneous and insufficient to draw definitive conclusions. Studies have found that the quality of life was improved when OCF was used for children with cerebral palsy. Others reported positive changes in pain and autonomic nervous system function. 
Methods: Male adult rats were used to determine blood-brain-barrier permeability following OCF. All animal procedures were approved prior to conducting in accordance with VT IACUC protocols. Anesthetized rats were treated with OCF therapy or control (sham). A board certified osteopathic physician with additional training in OCF performed OCF therapy on animals. Light pressure was held until the operator felt the tissue relax, which lead to enhanced lymphatic drainage. 
Next, the Lymphatic Pump Technique (LPT) was performed. The operator pressed the abdomen of the anesthetized rat with the thumb on one side and the index and middle fingers on the other side of the medial sagittal plane. The fingers were placed bilaterally, caudal to the ribs. Previous studies showed that similar procedures of LPT were successful [1-6]. 
Next Evans Blue (EB) solution was injected intravenously. After 24 hours, animals were transcardially perfused with saline, and brains were collected, weighed and homogenized. Supernatants of each tissue were measured. A second round of testing was conducted to determine if OCF influences CSF flow within the brain. Tracers were delivered into the cisterna magna of anesthetized rats and conjugated dextran and ovalbumin were administered. Ten minutes after infusion, rats underwent OCF and LPT. One hour following therapy, rats were transcardially perfused and fixed with 4% paraformaldehyde. Brains were collected, sectioned and tracer levels were measured. 
Data Analysis: EB dye concentration was calculated as the ratio of absorbance relative to the amount of tissue staining into the brain. Data were analyzed using 1-way ANOVA with Tukey post hoc t tests for pairs of data (OCF verses sham). Quantification of the fluorescent CSF tracers flow into the brain was conducted using NIH Image J software. Drainage was determined by measuring the distance of tracers into the brain. The fluorescence area coverage from the brain slices from each animal was averaged to define CSF penetration within a single biological replicate. 
Results: For the EB study, we found no significant difference (P=.89) between the brain homogenates, indicating that OCF did not cause BBB disruption in naïve animals. Brains have been collected from the tracer study animals and are in the process of begin analyzed. 
Conclusion: One possible explanation for the health benefit provided by OCF would be that the manipulation enhances the flow of CSF within the brain. This innovative research allows for tracking particles and the quantification of flow motion within the brain to begin modeling the physiological response to the OCF treatment. The basic knowledge gained will build a foundation for designing effective noninvasive rehabilitation therapies for TBI patients. 
Acknowledgment/Funding Source: Funds from the project were provided from the Via College of Osteopathic Medicine (VCOM) and the Institute of Critical Technology and Sciences (ICTAS) at Virginia Tech University. 
References
1. Creasy, C., et al., Thoracic and abdominal LPT inhibit the growth of S. pneumoniae bacteria in the lungs of rats. Lymphat Res Biol, 2013. 11.3: p. 183-6. 
2. Hodge, L.M., et al., LPT mobilizes leukocytes from the gut lymphoid tissue into lymph. Lymphat Res Biol, 2010. 8. 2: p. 103-10. 
3. Hodge, L.M., et al., LPT as an adjunct to antibiotics for pneumonia in a rat model. J Am Osteopath Assoc, 2015. 115, 5: p. 306-16. 
4. Huff, J.B., et al., LPT augments lymphatic flux of lymphocytes in rats. Lymphat Res Biol, 2010. 8,4: p. 183-7. 
5. Schander, A., H.F. Downey, and L.M. Hodge, Lymphatic pump manipulation mobilizes inflammatory mediators into lymphatic circulation. Exp Biol Med (Maywood), 2012. 237;1: p. 58-63. 
6. Schander, A., et al., LPT repeatedly enhances the lymphatic and immune systems. Lymphat Res Biol, 2013. 11:4: p. 219-26. 
*B31—Chronic Diseases and Conditions
A Mouse Model of Target Identification in the Presence of Novel Backgrounds 
Michael Castellano, PhD, OMS II1; Jared D. Cohn, OMS II2; Mitchell Swerdloff, OMS II2; James San Miguel, OMS II2; Reema Shah, OMS II2; Naveen Sharma, OMS II2; Nikesh Shah, OMS II2; Li Yan, PhD2; Gonzalo Otazu, PhD2 
1New York Institute of Technology COM 
2Department of Biomedical Sciences, New York Institute of Technology College of Osteopathic Medicine 
Statement of Significance: Autism affects millions of people and there is a wide variety of genetic models that have different behavioral phenotypes. We would like to establish a mouse model of autism that enables us to further consider variation in cranial bone structure and neuronal organization, including feedback and feedforward connections in the olfactory circuit, as it pertains to the osteopathic tenet of the interrelationship of structure and function. 
Methods: In order to test the generalization capabilities of mice we used an “olfactory captcha” task. We trained 9 head-fixed animals to perform a go/no-go task using a training set. Mice reached 90% performance after 8-10 days of training. We then tested the detection capability using a test set that included novel background odors that animals have never experienced before, similar to captcha used to distinguish humans from computers. Mice sniff rate increased when they were presented with the novel background odor indicating that the novel background was perceived as a novel odor. 
Data Analysis: We used an automated behavioral recording system and analyzed the responses of the animals using custom-written software in MATLAB. 
In order to determine if animals were using a feedforward algorithm, we used intrinsic optical imaging to record dorsal glomerular activation patterns to these odor combinations (training set) and used these data to create a linear classifier for detecting the target odors. 
Results: Mice correctly identified the target odors within the novel background odors. Intriguingly, mice required an extra sniff to respond to the target odor and mice response times were slower in the novel odor environment compared with the responses to the training set, which is consistent to the recruitment of recurrent circuitry to solve the task. We tested the learned linear classifier with odor mixtures that included a novel background odor (test set) and accuracy varied between 65% and 90% accuracy. However, the linear classifier did not predict the animal's performance, whereas a non-linear classifier performance correlated with animal behavior (r=0.51, P=.03). 
Conclusion: Our data indicate that animals are able to immediately generalize to novel odor environments and their performance required extra processing time, consistent with recruitment of recurrent circuitry in the bulb performing a non-linear classifier. 
Acknowledgment/Funding Source: I would like to thank the principal investigator, Dr Gonzalo Otazu, for his knowledge, insight, and dedication to teaching. 
References
1. Rokni, D., Hemmelder, V., Kapoor, V., Murthy, V.N. An olfactory cocktail party: figure-ground segregation of odorants in rodents. Nature Neuroscience. 17, 1225-1232 (2014). 
*B32—Osteopathic Philosophy
Determining the Best Strategy to Integrate Clinical Nutrition and Culinary Medicine for Preventative Health Education 
Lindsey Leggett, OMS III; Kareem Ahmed, OMS II; Cheryll Vanier, PhD; Amina Sadik, MS., PhD, MEdL, FIAMSE, FNAOME 
Touro Univeristy Nevada College of Osteopathic Medicine 
Statement of Significance: Nutrition is a crucial aspect of preventative health care, especially in osteopathic medical education. However, traditional medical curricula have designated little to no time in training future physicians in clinical nutrition and lifestyle counseling. This deficiency in knowledge and skill might be the cause of the lack of confidence to motivate and improve patients’ compliance in the management of nutrition-related chronic diseases as indicated by current physicians. 
Methods: The study design consisted of 2 surveys, 1 for the first and second-year cohorts (n=310) and a second for the third and fourth-year cohorts (n=240) of the Osteopathic Medical School at Touro University Nevada (TUNCOM). After IRB approval, the 2 surveys were deployed for 2 weeks. In addition to demographics, the survey questions for the first and second-year cohorts focused on the relevance of nutrition in disease prevention, student interest in a clinical nutrition elective supplemented by culinary medicine workshops, and lastly, preferences as to how the format, content, and structure of the course should be. The survey questions for the third and fourth-year medical students focused on their feelings of the usefulness of such an elective, its pertinence to the practice of medicine and whether they feel prepared to counsel patients who need to make lifestyle changes given the current level of nutrition education. Students in their clinical years were also asked to provide suggestions to improve the comprehension of clinical nutrition and medical students’ confidence in nutrition counseling. 
The survey questions were derived from published and validated questionnaires that were slightly modified to fit the objective of the study. 
Data Analysis: Analyses were done in Rv3.5.1. Phi coefficient and χ2 test used for different questions in the survey. 
Results: Although interest dropped by approximately 20% between pre-clinical years and the clinical years, more than 60% of students in all 4 years of medical school were interested in an elective nutrition course with a culinary medicine component. The most popular method of instruction depended on the year of the student, with first and second-year students preferring the in-class setting and third and fourth-year students preferring online PowerPoints. All levels of students preferred the “culinary session once every 2 weeks” format by a wide margin. The students who showed the highest interest in this elective reported that they were aiming for Family Medicine, Surgery, or were undecided. 
First and second-year students agreed or strongly agreed that nutrition counseling was an important component of patient care and that physicians are not adequately trained in nutrition. Students tended to be more modest in their assessment of a physician's ability to get a patient to change his or her lifestyle. First-year students had a more positive attitude regarding potential physician impacts compared with second-year students. 
Third and fourth-year students were on average neutral regarding their nutrition education, although they indicated that they should have had more time devoted to the subject. Fourth-year students were less satisfied with their nutrition education, on average compared with third-year students. 
Conclusion: The first and second-year students strongly agreed that nutrition counseling was an important component of patient care. It appears that medical students at TUNCOM are very interested in clinical nutrition with a culinary medicine component elective. As expected, students who plan to practice primary care are in 1 of the 2 top interested groups. Given the time constraint, the best option to teach the didactic component will be online using video taped PowerPoints. The culinary medicine component seems to interest medical students of all levels, given the high number of students signing up to participate in the 2 pilot sessions created to illustrate the impact of adequate foods to prevent or manage cardiovascular diseases that are nutrition-based. The overall results of the surveys and the success in garnering interest in the upcoming pilot sessions of culinary medicine should strongly demonstrate the need for the proposed elective. An evaluation of the first cohort completing this elective will be conducted, and improvement will be implemented accordingly. 
Acknowledgment/Funding Source: Our gratitude goes to Dr Findlay, chair of the Basic Science Department who supported the survey cost, Theresa Sanchez for preparing the surveys on SurveyMonkey and downloading the reports, and the International Association of Medical Educators (IAMSE) for the opportunities it provides to students through travel and research grants. 
Funding Source: IAMSE/ScholarRX Student Research Grant. 
*B33—Chronic Diseases and Conditions
Stability of Inhibitory Circuits in the Olfactory Bulb 
Jared David Cohn, OMS II1; Gonzalo Otazu, PhD2 
1 New York Institute of Technology College of Osteopathic Medicine 
2Department of Basic Science, New York Institute of Technology College of Osteopathic Medicine 
Statement of Significance: Through understanding the sensory deficits by the means of the DAT-CRE+ positive mice, it may be possible to understand the neurological basis of schizophrenia and new potential treatments for the condition involving manipulating the inhibitory circuitry of the central nervous system. Because the field of osteopathic medicine emphasizes mental health, through the behavioral model, researching the inhibitory interneuron circuits of the olfactory bulb to potentially develop new treatments to schizophrenia would enhance the future of osteopathic medicine. 
Research Methods: : The mice used in experiment were bred from a DAT-CRE+ line that was crossed with Ai95 in order to visualize the glomeruli and inhibitory neuron pathway within the olfactory bulbs of the mice. In the experiment odorants and mixtures were presented to the mice on 2 separate sessions 9 days apart. The mice were then placed into a chamber and 2 forms of imaging were conducted, intrinsic imaging utilizing 780nm light and fluorescent imaging using 470nm and when the odors were exposed to the mice the glomerular response was recorded. interneuron circuit remained unchanged. 
Data Analysis: Odors responses were calculated by dividing the average fluorescence during odor presentation by the average fluorescence preceding odor presentation. The signals were further denoised by calculating a z score average and the z score average image was used to draw ROIs using image J. The purpose of the ROI was to localize the response of the glomeruli within the olfactory bulb as a means to analyze the inhibitory circuitry of the olfactory bulb. Responses were compared using the drawn ROIs before and after odor exposure. 
Results: We observed that most of the fluorescence from the DATCRE glomeruli were relatively constant over periods of 1 month suggesting that the short axon cells have relatively stable responses over months. 
Conclusion: Given the stability of the short axon cells, we wonder if in the mouse model of schizophrenia will remain stable, and if not it, it may be possible to manipulate the inhibitory circuit to stabilize, which may serve as a treatment to schizophrenia 
Acknowledgement/Funding Source: Acknowledgments: Dr Otazu for his great support and wisdom. Dr Otazu utilized startup funds from the New York Institute of Technology College of Osteopathic Medicine. 
References
1. Banerjee, Arkarup, et al. “An Interglomerular Circuit Gates Glomerular Output and Implements Gain Control in the Mouse Olfactory Bulb.” Neuron, vol. 87, no. 1, 1 July 2015, pp. 193-207. doi:10.1016/j.neuron.2015.06.019 
*B34—Chronic Diseases and Conditions
The Effects of EBOV sGP on Macrophages via RNA-Sequencing 
Miriam Ruth Brown, OMS III1; Chelsea J. Weidman, MS2; Jillian H. Bradley, PhD2 
1The Edward Via College of Osteopathic Medicine - Carolinas Campus 
2Department of Microbiology and Immunology, The Edward Via College of Osteopathic Medicine - Carolinas Campus 
Statement of Significance: When a person is infected with Ebola, if they are able to live long enough to develop antibodies, they will most likely recover. Therefore, understanding how Ebola affects cells of the early immune response, such as macrophages, could have implications for developing a targeted treatment for acute infection. During infection, large quantities of the secreted form of the glycoprotein (sGP) are found in the serum, suggesting a role in the pathogenesis of the virus. Previously, this laboratory found that when macrophages were exposed to sGP, production of the pro-inflammatory cytokines was inhibited. To uncover the mechanism behind this inhibition, the experiment was repeated and samples were sent for RNA-sequencing. 
Methods: THP-1 monocytes are seeded in a 96-well, flat bottom plate at 200k/mL and stimulated into macrophages with a 3 day incubation period with PMA (200uM), followed by a 5 day rest. In order to polarize the macrophages to the M1 phenotype, Interferon-γ (20 ng/mL) is added for 24 hours. After 24 hours, the cells are adherent to the plate and are washed with PBS and the media refreshed. Lipopolysaccharide (LPS, 1 ug/mL) is added to activate the M1 cells for another 24 hours. After 24 hours, the cells are washed with PBS to remove the LPS and the media is refreshed. EBOV sGP (8 ug/mL) is added to the cells for 24 hours. The cells were collected via trypsonization. The cells were removed from the plate and centrifuged. The pellet of cells was then disrupted with Buffer RLT and moderate vortexing. The samples were then snap-frozen in liquid nitrogen and shipped on dry ice to Qiagen NCS for processing. 
Data Analysis: The data showed over 70 million reads per sample, and an average of 20 thousand genes and 80 thousand isoforms were identified. A radar plot, principle component analysis, and heat map all showed clustering within the sample groups, indicating both high quality data and further highlighting differences in gene expression between the 2 groups. The radar plot shows consistency in the number of genes identified in each sample. The heat map demonstrates the upregulation and downregulation of genes. The principal component analysis shows how well the sample groups cluster based on the genes that have the largest coefficient of variation, showing that the clustering is based on biological differences. On average, 85% of a sample's data were able to be mapped using gene ontology (GO) analysis. The most significant GO term was modulation by a virus of host morphology. Other significant GO terms included inflammatory response, regulation of transcription, intracellular protein transport, and regulation of small GTPase mediated signal transduction. 
Results: The results of the mRNA-sequencing data show significant differences between the samples of LPS activated macrophages exposed to sGP and LPS activated macrophages not exposed to sGP. Clustering within the sample groups was observed, indicating high quality data and a difference in gene expression due to sGP exposure. In addition to the gene expression analysis showing large numbers of significantly differentially expressed mRNA at the CDS (Coding DNA Sequence), a large number of novel isoforms were identified. Based on the unsupervised clustering analysis, the underlying biology of the samples is causing the largest variation between the samples. 
Conclusion: Continued research is underway to combine the lists of the most significantly differentially expressed genes and isoforms, the GO terms and network, and our current knowledge of Ebola Virus and the human body to uncover the mechanism of sGP inhibition of pro-inflammatory cytokine production by macrophages. 
It is important to recognize that, while this mRNA-sequencing experiment provides a wealth of information, there are limitations. mRNA-sequencing only provides a single snapshot of the content of the transcriptome, while a living cell has an ever changing environment. This limitation was addressed by keeping data collection times consistent across experiments, as well as submitting multiple samples with the same exposure and conditions for analysis. Additionally, mRNA-sequencing does not reflect changes that occur with protein translation and posttranslational processing of proteins. While this is simply the nature of mRNA-sequencing, it is something to keep in mind for further inquiry to Ebola Virus pathogenesis. 
Acknowledgment/Funding Source: We would like to thank many people for their contributions. mRNA ngs Data Analysis report performed by QIAGEN Genomic Services. Dr Randal Gregg assisted with mechanism guidance. This projected was funded by the Research Eureka Accelerator Program, generously provided by The Edward Via College of Osteopathic Medicine. 
References
1. Lee JE, Saphire EO. Ebolavirus glycoprotein structure and mechanism of entry. Future Virol. 2009;4(6):621-635. doi:10.2217/fvl.09.56 
2. Bradley, J., A. Harrison, A. Corey, N. Gentry, and R. Gregg. 2017. Ebola virus secreted glycoprotein decreases the anti-viral immunity of macrophages in early inflammatory responses. Cellular Immunology. ISSN 0008-8749, doi:10.1016/j.cellimm.2017.11.009. 
3. CDC. Ebola (Ebola Virus Disease). Accessed 03/31/2019. https://www.cdc.gov/vhf/ebola/index.html 
*B35—Chronic Diseases and Conditions
Tap Water Components and Their Effect on Cell Adhesivity, a Model for Brain Development 
Rachel Anne Hall, OMS III1; Sara Abdelnour, OMS III1; Anam Jafri, OMS IV1; Chevon Thorpe, PhD2; Terry Hrubec, DVM, PhD3 
1Edward Via College of Osteopathic Medicine, Virginia Campus 
3Anatomical Sciences,Edward Via College of Osteopathic Medicine, Virginia Campus 
Statement of Significance: We found cell viability was decreased at the concentration of contaminants present in tap water. Interactions between the contaminants and zinc were also observed. In addition, trials showed increased adhesivity of the cells, indicating an increased risk for neural tube defects. These results are concerning, as they indicate interactions between common water contaminants could cause health problems at concentrations currently found in tap water. Neural tube defects have a life long impact on affected patients and can contribute to health problems including somatic dysfunctions. Results and continuation of this research may lead to increased ability to prevent neural tube defects during embryologic development. 
Methods: The C6 glioma Adhesivity Assay is an in vitro assay used to model neural tube defect formation. Increased cell adhesion of rat glial cells to the culture substrate translates to decreased cell migration in the developing neural tube (brain). We previously found increased cell adhesivity with a combination of the common tap water contaminants, glyphosate and naturally occurring zinc (Zn). Thus these components, when combined, could act synergistically to increase teratogenic potential and could be contributing to neural tube defects. This combination of glyphosate and zinc, however, decreased cell viability. 
The present study built on these initial findings to investigate possible synergistic effects of other water contaminants on cell adhesivity and reduction in viability. The Trypan Blue dye exclusion and Alamar Blue Cell Proliferation Assays were used to measure reduction in cell viability. The C6 Glioma Assay was used to measure adhesivity. Combinations of the common water contaminants glyphosate (Roundup®) and atrazine, 2 herbicides, and quaternary ammonium disinfectants were tested with varying concentrations of Zn. Adhesivity was tested by growing exposed C6 Glioma cells on glass slides and then centrifuging slides to measure adhesion to the slide. Viability of cells following exposure to combinations of the contaminants was determined with the above assays. 
Data Analysis: The Trypan Blue dye exclusion and Alamar Blue Cell Proliferation Assays were used to measure reduction in cell viability. The C6 Glioma Assay was used to measure adhesivity. We found cell viability was decreased at the concentration of contaminants present in tap water. Interactions between the contaminants and Zn were also observed. In addition, trials showed increased adhesivity of the cells, indicating an increased risk for NTDs. 
Results: We found cell viability was decreased at the concentration of contaminants present in tap water. Interactions between the contaminants and Zn were also observed. In addition, trials showed increased adhesivity of the cells, indicating an increased risk for NTDs. 
Conclusion: We found cell viability was decreased at the concentration of contaminants present in tap water. Interactions between the contaminants and Zn were also observed. In addition, trials showed increased adhesivity of the cells, indicating an increased risk for NTDs. The results are concerning, as they indicate interactions between common water contaminants could cause health problems at concentrations currently found in tap water. Further research needs to be completed in this area to establish the risk to the public and potential for interventions. 
Acknowledgment/Funding Source: This Research is sponsored by Hrubec et al REAP Grant. 
*B36—Chronic Diseases and Conditions
Expression Profile of Host Kinase RIOK3 During Rotavirus Infection 
Cade Colby Walker, OMS II1; Caitlin Sax, 2; Juanita Ratliff, BS3; Michelle Vanoy-Warner, BS3; Crystal Boudreaux, PhD3 
1West Virginia School of Osteopathic Medicine 
2Concord University 
3Department of Biomedical Sciences, West Virginia School of Osteopathic Medicine 
Statement of Significance: Rotaviruses are the leading cause of childhood enteric death worldwide. In the state of West Virginia, diarrhea-related illnesses are the second most common type of disease outbreak, of which the fourth leading cause are rotaviruses. Viruses are known to utilize host cell factors and signal pathways to control an environment ideal for replication. Rotaviruses are eleven-segmented double-stranded RNA virus that utilizes a variety of host proteins, but little is known of their structure and function in regards to virus replication. Furthermore, determining the function of these kinases during infection could lead to interventions for other known diseases that are linked to kinase dysfunction such as Peutz-Jeghers Syndrome. 
Research Methods: African Green monkey kidney cells (MA104 cells) were incubated at 37°C in 5% CO2 complete medium 199 (M199). Rotavirus infections were performed using a simian strain SA11-4F at a multiplicity of infection of 10 (MOI=10) in serum free M199. Mock and infected cell lysates were collected 10 hours post-infection and separated using SDS-PAGE gel electrophoresis. Knockdown of STK11IP was performed through transfection reactions using Silentfect Lipid Reagent and OptiMEM medium to allow introduction of STK11IP-siRNA to MA104 cells. Following a 48-hour incubation period, cells were infected with SA11-4F as described above. Whole cell lysates were collected and analyzed by Western Blot analysis using antibodies specific for RIOK3, STK11IP, and viral protein 2 (VP2). 
Data Analysis: Protein quantitation was performed using Western blot band detection analysis and pixel quantitation by Image J (NIH). The numerical value of ten replicates were used in each experimental group for analysis. The t test (Excel) was used to determine statistical significant difference between experimental groups. 
Results: Whole cell lysates were analyzed by western blot using mouse monoclonal antisera against RIOK3 or rabbit polyclonal antisera against STK11IP. The results show that a 59-kDa band consistent with the size of full-length RIOK3 was detected in both mock and infected MA104 cells at 10 hours post infection. We observed that the levels of RIOK3 showed unremarkable differences in expression between mock and infected lysates, as well as the knockdown of STK11IP in both the mock and infected cell lysate samples. 
Conclusion: RIO kinase 3 (RIOK3) was identified using an RNAi approach that focused on cellular kinases. RIOK3 was an intriguing candidate because it is a member of the right open reading frame kinase gene family that encodes a serine/threonine kinase that localizes to the cytoplasm. RIOK3 plays a role in the processing of the pre-40 S ribosomal subunit, which could play an important role in viral replication as viruses use host ribosomes to effectively synthesize protein. Interestingly, serine/threonine kinase interacting protein (STK11IP) was also shown to be upregulated during rotavirus infection. As an upstream regulator of the AMP-regulated protein kinase (AMPK) pathway that plays a role in protein metabolism, we sought to identify if RIOK3 might also interact with STK11IP. Our data showed that there was no significant difference in the expression of RIOK3 during 10 hours post rotavirus infection. There was also no significant difference in expression of RIOK3 in the reduced expression of STK11IP. These data suggested that RIOK3 may not play a role during late rotavirus infection but perhaps may be differentially expressed at an earlier time point post infection. Ongoing experiments will test different time points post infection. RIOK3 expression will also be reduced to test whether the expression of STK11IP is reciprocated in the same manner as RIOK3 during STK11IP knockdown. 
Acknowledgement/Funding Source: We would like to acknowledge the technical staff and scientific community at West Virginia School of Osteopathic Medicine (WVSOM), other members of the Boudreaux lab for helpful discussions, Drs. John Patton and Sarah McDonald for reagents and rotavirus strains, and the West Virginia IDeA Network of Biomedical Research Excellence (NIHP20GM103434) and WVSOM for funding. 
B37—Chronic Diseases and Conditions
Disinfectant Exposure Decreases Reproductive Hormones 
Terry Hrubec, PhD; Pamela Vieira, DO; Valerie A. McDonald, MS 
Edward Via College of Osteopathic Medicine (Virginia) 
Statement of Significance: QAC disinfectants are common in the medical setting. We found 50% of osteopathic students and faculty had ADBAC residues on their hands, 80% had concentrations in the blood. In mice, QAC exposure causes decreased sperm counts and mobility in males; and decreased ovulations, implantations, and impaired heat cycling in females. ADBAC inhibits cholesterol synthesis, needed for steroid hormones; and binds to the estrogen receptor, interrupting normal signaling. Both actions could alter FSH and LH levels. FSH and LH are secreted in response to gonadotropin releasing hormone (GnRH) and act on the gonads to produce estrogen and testosterone. These act in a feedback loop regulating GnRH production. Disruption of this cycle can impair reproduction. 
Methods: Three groups of CD-1 mice were used: unexposed controls; a group receiving ambient exposure from use of the disinfectant in the mouse room; and a third group receiving 60 mg/kg/day ADBAC+DDAC in the feed in addition to the ambient exposure. Male and female parents were exposed for 10 days prior to breeding and then through gestation and lactation. At weaning, exposed juveniles were moved to an ADBAC+DDAC free environment. In each group, 8 litters were reared. A single male and female from each of the 8 litters were bled at 40 days of age. Juvenile mice at this age are pre-pubertal and do not have diurnal fluctuations in hormonal concentrations. 
Data Analysis: Concentrations of FSH and LH in males and females of the 3 treatment groups were determined by ELISA. Statistical analysis was conducted by t test with significance set at P<.05 
Results: FSH and LH concentrations were decreased in both male and female mice. Both ambient and dosed exposure reduced FSH and LH. The ambient group of mice were exposed to normal use of disinfectants in the mouse room. This models human exposure from normal use of disinfectants in daily activities. 
Conclusion: This study shows that ADBAD+DDAC disinfectant exposure disrupts reproductive hormonal signaling in mice. While this study did not evaluate all of the components of the hypothalamic-pituitary-gonadal-axis, it did identify hormonal changes that could directly cause reduced reproduction in both males and females. This finding indicates that QAC disinfectant exposures may disrupt normal reproductive hormonal signaling in humans. 
Acknowledgment/Funding Source: Supported by VCOM VMCVM One Health grant program. All procedures were approved by the IACUC # 16-069. 
*B38—Chronic Diseases and Conditions
Mir-26a Overexpression Causes Increased Proliferation and Dysregulation of the Wnt Pathway in the Bipotential C2C12 Cell Line 
Josiah Eschbach, OMS III1; Elisha Pendleton, MS2; Phillip Rasnick, OMS III2; Nalini Chandar, PhD2 
1Midwestern University Chicago College of Osteopathic Medicine 
2Department of Biochemistry, Midwestern University Chicago College of Osteopathic Medicine 
Statement of Significance: This research is significant to increase our basic understanding of normal homeostatic mechanisms involved in bone development as well as to elucidate possible factors in the progression of Osteosarcoma. 
Research Methods: In order to further investigate the role of miR26a we stably transfected and overexpressed this miRNA in C2C12 cells and characterized them. Stably transfected C2C12 cells overexpressing miR26a were isolated and 2 single cell clones were chosen for further analysis. To analyze cell cycles, cell lines were starved for 24 hours on serum free media to sync cell cycles and then put on 10% FBS DMEM for another 24 hours. Cells were then harvested, dyed with propidium iodide, and processed with a flow cytometer for cell cycle analysis. Additionally, a cell proliferation assay was performed in triplicate by growing each line for 24, 48 and 72 hours and counting cells using an automated counter. Men1 and Beta catenin RNA levels were measured using quantitative realtime PCR (qRT-PCR). Protein expression was monitored using western blot analyses. 
Data Analysis: Data analysis was performed with through use of an automated cell counter, flow cytometry software, and qRT-PCR software. 
Results: 2 clones of C2C12 cells that showed a 2- and four-fold increase in miR26a expression respectively were chosen for further analyses. When we compared the cell cycle distribution of the stably transfectected cells to parent C2C12, we noticed a 10% and 13% increase cells in S and G2M phase for transfected clones respectively. Growth rates for the proliferation assay matched the cell cycle distribution and showed a miRNA dose dependent increase with time. Our qRT-PCR data demonstrated an increase in Beta catenin expression while Men1 protein expression remained unchanged. There was also a dose dependent decrease in Men1 as miR26a expression increased. A decrease in active GSK-beta (which targets beta catenin for degradation) was noted in western blot analyses, which confirmed the reason for the lack of increase in beta catenin protein expression. Our results indicate that miR26a when overexpressed behaves as an oncogene and increases growth in the bipotential C2C12 line. Dysregulation of beta catenin function by excess miR26a indicated that mR26a must play a role in its regulation. Furthermore, we detected a putative miR26a target site in the GSK-beta mRNA suggesting the likelihood of a direct regulation. Additionally, our studies indicate a decrease in Men1 caused by miR26a overexpression. Loss of tumor suppressor Menin function could also account for the increase in cellular proliferation seen in our analysis. 
Conclusion: Menin functions through miR26a to regulate the beta catenin pathway. miR26a is oncogenic in C2C12 cells. GSK-beta is a likely target of miR26a helping to maintain beta-catenin levels during differentiation. 
Acknowledgement/Funding Source: Research funds from MWU to support Josiah Eschbach's summer felllowship is gratefully acknowledged. 
*B39—Chronic Diseases and Conditions
MST-312 Suppresses Herpes Simplex Virus Replication in Primary Human Cells 
Alyssa Averhoff, OMS II1; Prajakta Pradhan, MS2; Marie L. Nguyen, PhD2 
1Des Moines University College of Osteopathic Medicine 
2Department of Microbiology, Des Moines University College of Osteopathic Medicine 
Statement of Significance: Over 2-thirds of the US population is infected with HSV. While severe outcomes of HSV infections are rare, the high proportion of infected individuals increases the need for effective treatments. Almost all current therapies for HSV, such as Acyclovir, rely on the viral thymine kinase enzyme and target the viral polymerase protein. Long term use of these therapies can lead to resistance, which has been increasingly problematic in immunocompromised patients. As resistant strains of HSV to current therapies emerge, it is imperative to develop treatments which target distinct steps in HSV's life cycle. 
Research Methods: Trypan blue exclusion tests were used to measure the cytotoxicity of MST-312. Cells were incubated with 20 μM MST-312 and equivalent volume DMSO were incubated for 18 hours and then trypsinized and stained with trypan blue, which is taken up by dead cells. Cells were then counted under light microscopy and the percentage of dead cells was determined. The ability of MST-312 to limit infectious virion production was assessed using a single cycle growth experiment. Primary neonatal human keratinocytes were infected at an MOI of 5 in the presence of 20 μM MST-312 or the equivalent volume of DMSO, which was used as a control. At 18 hpi, the virus was harvested from the cells and media. The infectious virus was quantified using a plaque assay. Briefly, serially diluted virus samples were used to infect confluent monolayers of Vero cells. At 72 hpi, monolayers were fixed, stained with Giemsa, and counted for plaques with visual inspection and microscopy. In a separate set of experiments, infected keratinocytes were harvested for protein analysis. Total cellular proteins, were separated by SDS-polyacrylamide gel electrophoresis (PAGE), transferred to a nitrocellulose membrane, and immunoblotted for multiple viral proteins and cellular actin. 
Data Analysis: Trypan blue exclusion tests and single cycle growth experiments were performed in triplicate. Statistical significance was determined through a t test 
Results: Trypan blue exclusion tests showed no increase in cytotoxicity with MST-312 compared with control DMSO. The results of the plaque assays indicated a significant reduction in infectious virion production occurred with 20 μM MST-312 treatment compared with DMSO control treatment. Immunoblotting indicated an inhibition of viral protein accumulation with 20 μM MST-312 in keratinocytes. 
Conclusion: Our results indicate MST-312 inhibits the HSV-1 infection of primary human neonatal keratinocytes, without a significant increase in cytotoxicity. While additional studies are needed to assess MST-312's ability to be an effective treatment for HSV, this study provides valuable insight on its ability to limit infection in primary human cells. 
Acknowledgement/Funding Source: Iowa Osteopathic Education and Research Fund and the Mentored Student Research Program. 
Clinical
C1—Chronic Diseases and Conditions
Pemphigus and Pemphigoid Pre-Symptom Lifestyle Survey: An Attempt to Identify Potential Epigenetic Factors in Autoimmune Bullous Dermatoses 
Mandy Alhajj, OMS III; Adam Gromley, PhD; Vinayak K. Nahar, MD, PhD 
Lincoln Memorial University - DeBusk College of Osteopathic Medicine 
Statement of Significance: This research is significant to osteopathic medicine because it explores some of the many factors that can play a role in the health of an individual. Diseases like pemphigus and pemphigoid are multifactorial in nature and require an understanding of each patient as a whole, including their genetics, life circumstances, environment, and emotional wellness. Furthering our understanding of the complicated interplay between our body systems at the molecular level with our environment is invaluable to advancing our approach to medicine and seeking prevention of disease onset. 
Methods: This study was a descriptive cross-sectional for those with pemphigus or pemphigoid disease within the International Pemphigus and Pemphigoid Foundation (IPPF) database. Survey materials were sent by email, required electronic consent, a minimum age of 18, and access to an electronic device. Responses were received from the United States, United Kingdom, Canada, Europe, Middle East, Australia, South America, and India with a total of 397 participants. Participation was voluntary. The survey asked about lifestyle and external environmental factors that existed prior to the onset of disease symptoms. The survey collected nominal data on gender, specific diagnosis, age of disease onset, allergies, exercise, food content, pre-selected stress events, major stress events, and significant moments and descriptive data on occupation, allergies, stress events, and significant moments. 
Data Analysis: Survey responses were exported from the online server and onto excel. Nominal data were analyzed and graphed, while written responses were reviewed and re-categorized using key words. Foods were charted and found to be near equal across most responses, so there was no further analysis. Occupations were re-categorized into the following: architecture and engineering, art and communications, computers and technology, education and social services, factory work, health care and allied health, homemaker, hospitality/tourism/service industry, law and law enforcement, management/business/finance, military, retired, science, student, trades and transport, and unemployed. Specific allergies mentioned were reviewed and the most frequently mentioned allergies were selected. Written responses for major stressful life events were reviewed and tallied for the mention of stress as a result of divorce, work, home life, romantic relationships, friendships, finances, school, illness in family/friends/pets/self, death in family/friends/pets, care giving, illness in self, multiple or frequent surgeries, recent dental cleaning or procedures, physical or emotional trauma, pregnancy, birth, difficult pregnancy, medications, new or lost home/job, major moves to new city/state, and retiring. Written responses of significant moments were reviewed and re-categorized into personal/social events, health events, and occupational events. The optional written responses were reviewed and were not analyzed. 
Results: The survey had a 91.4% completion rate. Females predominated at 73%51.85% diagnosed with pemphigus vulgaris, 21.43% bullous pemphigoid and 19.05% mucous membrane pemphigoid. Disease onset increased with age, highest in over the age of 60 at 34.31% and 26.60% between ages 51 and 60. Notable occupation categories were, management/business/finance, health care/allied health, and education/social services (30.77%, 14.06%, 12.79%). The pre-selected stress events with the most positive responses were ever having surgery, 31.71%, having a minor bacterial or viral infection, 22.41%, and using tobacco products, 15.43%. Exercise frequency was highest (34.76%) at 1-2 times per week, 28.88% 3-4 times per week, 20.86% never exercising, and 15.51% exercising 5 or more times per week. Stressful major life events prior to disease symptom onset were experienced by 68% with an average 2.16 events per respondent. The most commonly mentioned events were stress from work at 13.23%, death of a family member/significant other/friend at 9.62%, home/family life at 9.22%, and stress from ill family member/significant other/friend at 8.42%. The descriptors intense, severe, constant, crisis, and statements including “life in general” were often used to describe stress. Significant moments near symptom onset were experienced by 55% with mention of sudden stress/anger, exposure to extremes in heat, travel to hot, tropical, dry locations, recent illness with antibiotic or anti-fungal use. 
Conclusion: Autoimmune bullous diseases are complex and difficult to study with multiple potential factors that could play a role in the onset of disease symptoms. These diseases have genetic components and are thought to be multifactorial, meaning that 1 or more epigenetic or external factors can cause the body enough insult to trigger disease in people with certain genetic mutations. The goal of this study was to ask patients with pemphigus and pemphigoid disease about their life prior to disease symptoms in an effort to find areas that could be studied more in depth in the future. 
There may be a relationship between experiencing multiple stress events, particularly extremes in emotion, environmental changes, and persistent stress events with onset of disease, especially in conjunction with stressful occupations. We cannot claim that stress is causal in autoimmune bullous dermatoses, but that the body's response to stress may play a role. Future studies focused on the physiological response to stress and coping mechanisms to stress in individuals with genetic susceptibility could be promising, but we cannot exclude other external factors. 
Acknowledgment/Funding Source: International Pemphigus and Pemphigoid Foundation. 
*C2—Osteopathic Philosophy
Osteopathic Medical Students: Promoting Physical Activity 
MS, FRSPH1; Adrienne Law, PGY-II1; Lucas Hollar, PhD2; Elliot Sklar, PhD2; Peter Sprague, PT, DPT, OCS3 
1Nova Southeastern University Dr. Kiran C. Patel College of Osteopathic Medicine 
2Master of Public Health Program, Nova Southeastern University Dr. Kiran C. Patel College of Osteopathic Medicine 
3Department of Physical Therapy, Emory University School of Medicine 
Statement of Significance: Osteopathic medicine is looking at the patient as a whole person, including their lifestyle. With the AOA/ACGME merger, there is an increased number of DO-trained medical learners doing rotations and residencies with MDs who did not learn medicine in this way. Promoting viewing patients as a whole person among our allopathic colleagues can be a special osteopathic distinction promoting health among ourselves and therefore, our patients. 
Research Methods: Utilizing a cross-sectional design, in partnership with the Student Osteopathic Medical Association (SOMA) and Nova Southeastern University Dr. Kiran C. Patel College of Osteopathic Medicine (NSU-KPCOM), we conducted an online survey of third and fourth year OMS across USA, from August through December 2015. The survey collected self-reported data on frequency and duration of vigorous and moderate physical activity per week. Students were also asked to name the top 3 barriers to physical activity in free-response text. 
Data Analysis: We performed statistical analyses using SPSS version 22.0 (IBM Corp., Armonk, NY). We used descriptive statistics to describe the OMS physical activity levels in days per week, minutes per day, and minutes per week of both vigorous and moderate physical activity. We used a 1 sample t testto determine differences between OMS physical activity and the ACSM minimum recommended level of 150 minutes per week. Tests were 2-tailed, and p values < .05 were considered significant. 
Results: Most participants (60.7%) met or exceeded the American College of Sports Medicine (ACSM) physical activity guidelines of at least 150 minutes of moderate intensity aerobic activity per week. The OMS respondents’ mean of 215 minutes of physical activity per week significantly exceeded the ACSM recommendation (P=.000). The top 4 barriers identified by OMS in terms of word frequency (no qualitative analysis) were a lack of Motivation, a lack of Energy, Studying, and Time. Sixty-four percent of OMS met the recommendation of 150 minutes, and 13% identified a lack of Motivation 15% identified a lack of Energy 20% identified Studying and, 72% identified Time. These barriers are not associated with meeting or not meeting the recommended 150 minutes. There was a significant difference between Time-alone (217 min) and Motivation-alone (96 min). We studied Time-alone and Motivation-alone in a logistic regression model with Meeting or Not Meeting Recommended Level of physical activity as the dependent. OMS who identified Motivation, without time, as a barrier were 6.5 times more likely to not meet the recommended 150 min of physical activity. 
Conclusion: OMS are well positioned to become physically active physicians and, in turn, promote physical activity in their patients. Future studies may look at barriers to physical activity in medical students and attempt to increase participation in active lifestyles in this population. Future studies may also look at how osteopathic physicians can make a positive influence in promoting wellness among their allopathic colleagues and their patients. Additionally, finding that OMS who identify Motivation as a barrier have significantly lower levels of physical activity is noteworthy. Perhaps, if OMS are adequately trained in motivational interviewing, this technique could help a vulnerable portion of OMS increase their levels of physical activity, and the OMS could use the technique on their patients as they become acting physicians. 
References
1. American Association of Colleges of Osteopathic Medicine. (2017). What is Osteopathic Medicine? Available at: http://www.aacom.org/become-a-doctor/about-om [Last accessed 26 January 2017]. 
2. Blair, S. N. (2009). Physical inactivity: the biggest public health problem of the 21st century. British Journal of Sports Medicine, 43(1), 1-2. doi:10.1016/S1440-2440(07)70066-X 
3. Bushman, B. A. (2017). American College of Sports Medicine's Complete Guide to Fitness & Health - 2nd Edition. 
4. Centers for Disease Control and Prevention. (2010). The Association Between School-Based Physical Activity, Including Physical Education, and Academic Performance. 
5. Lee, I. M., Shiroma, E. J., Lobelo, F., et al. (2012). Effect of physical inactivity on major non communicable diseases worldwide: an analysis of burden of disease and life expectancy. Lancet, 380(219), 219-229. doi:10.1016/S0140-6736(12)61031-9 
★*C3—Osteopathic Philosophy
Effects of Social Media on Patient Perceptions and Compliance 
Annmarie Butare, OMS III; Adarsh Gupta, DO, MS, FACOFP 
Rowan University School of Osteopathic Medicine 
Statement of Significance: Patient beliefs regarding their condition and treatment directly influence compliance. Physicians must understand how their patients develop these beliefs. Many Americans use social media for medical information, yet its accuracy is concerning. How does this affect one's health care decisions? With patients playing a more active role in their health care, physicians must be aware of their information seeking behaviors and how they affect attitudes toward their health care. In holding true to the osteopathic foundation of patient centered care, we can optimize the shared decision making model with improved understanding of social media use and its effect on patient beliefs toward their care and thus improve compliance. 
Research Methods: This cross-sectional study involved a 15-item voluntary questionnaire in a paper survey completed by patients while at their medical office visit. The researcher was present at 1 of 4Rowan University School of Osteopathic Medicine Family Medicine practice locations in Stratford, Hammonton, Mount Laurel, or Sewell, New Jersey. Data collection was completed from June 12th through July 19th 2018, during normal office hours. 
The only exclusion criterion was less than 18 years of age. Upon completion of the nurse's visit with each patient, the researcher entered the patient examination room and discussed the survey with the patient. The patients either agreed or declined to participate after the researcher confirmed their understanding of the study goals and the anonymity of the survey. The patients were assured that their responses would not affect their current office visit. If agreed, the consent form and survey were completed before the physician entered the examination room. All paper surveys were collected and entered into Qualtrics. All surveys that were partially or completely completed were included in the analysis. Paper copies were stored at the Rowan SOM Stratford office. Section 1 of the survey encompassed patient demographics. Section 2 discussed social media use. Section 3 included a series of belief statements and attitudes to which the participant responded on a 5-point Likert Scale from “Strongly Agree” to “Strongly Disagree”. Entire study received IRB approval. 
Data Analysis: 298 patients were approached for this study. 270 patients agreed to complete the survey. Reasons for not completing the survey included inadequate time to complete the survey, lack of reading glasses, feeling too ill, or no desire to participate. The average age of this study sample was 52 years old, ranging from 18-91. The male to female distribution was 34.4% male to 65.6% female. All survey data was analyzed using SPSS software. Statistical measures included correlational analysis, Levene's test for quality of variances, independent t test, and paired t test. 
Results: 75% of patients use social media regularly. 40% and 52% use social media to learn about medical conditions and national health issues, respectively. Social media use is positively correlated with fear of the opioid crisis and poor compliance. Reasons for using social media proved to be significantly correlated to health information seeking. The total number of social media sources used is strongly correlated with health information seeking attitudes. Furthermore, there is also a positive correlation between agreement that “News regarding the opioid epidemic has made me fearful of taking medications” with health information seeking and attitudes about the opioid crisis. No significant correlations were found with factors pertaining to family history of addiction, illicit drug use or alcohol abuse. However, there was a positive correlation between family history of opioid addiction and worry about the US opioid epidemic. Patient adherence is strongly correlated with effective education from their physician. Adherence to physician recommendations is significantly correlated with patient education regardless of social media use and attitudes on the opioid epidemic. 
Conclusion: There are significant correlations with patient compliance and patient education as well as patient compliance and social media use; with patient education improving compliance and social media use decreasing compliance. Therefore, it is easy to postulate that improved patient education by one's physician will improve their compliance with health recommendations. However, how can physicians improve patient education, considering the significant number of patients using social media and internet platforms to gather information and formulate attitudes and beliefs? How can we ensure that our patients’ beliefs about health care is accurate and will not harm their decisions? There is a significant correlation between social media use and news reports with fear about the opioid crisis. Those who reported increased fear of the opioid crisis are less likely to follow physician recommendations. There was a strong negative correlation with increased age and increased social media use, and a significant positive correlation with age and trust in the patient's physician and compliance. Physicians must consider the fact that older patients are less likely to learn about their health from outside sources. Physicians must ensure that their patients are collecting credible and accurate information, incorporating this into their patient education in order to ensure patient understanding of the information gathered both outside and inside the medical office to improve compliance and outcomes. 
Acknowledgement/Funding Source: Research funding provided by Rowan University School of Osteopathic Medicine, Department of Family Medicine. The authors wish to thank Rowan University for their dedication to research. 
*C4—Chronic Diseases and Conditions
The Efficacy of Osteopathic Manipulative Treatment on Decreasing the Severity of Migraine Headaches 
Abby Rhoads, DO; Martha M. Metzgar, DO; Patricia Donovan, DO, PGY3 Resident 
Department of Family Medicine, St. Luke's University Hospital/Philadelphia College of Osteopathic Medicine 
Statement of Significance: Historically, OMT was believed to worsen migraine headaches, this study is being conducted to learn about how Osteopathic Manipulative Treatment can help migraine patients. Participants receiving OMT could benefit from improved quality of life by decreasing participant's severity and frequency of their migraine headaches, which could improve their productivity to society and decrease the economic burden of migraine headaches. Headache accounts for the fourth or fifth most common reason for emergency department visits and the economic burden of migraine reaches $78 billion dollars per year. This could provide information to acknowledge OMT techniques evaluated by this study as a recognized treatment of migraine headaches. 
Research Methods: After IRB approval, participants were recruited at St. Luke's Family and Internal Medicine departments in Bethlehem, Pennsylvania. A total of 140 participants will participate ( n=70 intervention group, n=70 control group), and this is an interim analysis of the first ten patients enrolled. Participants 18-50 years old, male and female, with diagnosis of migraine with or without aura, any ethnicity or race who agree to OMT will be included. Exclusion criteria include: previous surgery to neck or cranium, history of previous stroke, more than 2 daily prophylactic pharmacologic agents, active cancer, receiving BOTOX for migraines within the last 4 months, contraindications for OMT such as clinical signs of fractures in cervical spine, unable to follow commands, seizure disorder or recent head trauma. The intervention group will receive OMT for 30 minutes at 0, 2, 6, 10 week time-points, participants take MIDAS and HIT-6 questionnaires at baseline prior to first treatment and then at completion of 12 weeks. The Manipulative Medicine Protocol includes the following treatments: OA release, muscle energy and soft tissue to mid trapezius muscle, muscle energy to cervical spine in all 3planes of flexion/extension, rotation and side bending, screening for tender points of C2-C6 at transverse and spinous processes followed by counterstain if a tender point is identified, soft tissue to cervical paraspinal muscles, myo-fascial release of frontal forehead, and CV4 cranial technique. 
Data Analysis: Using PASS software [Hintze, J. (2011). PASS 11. NCSS, LLC. Kaysville, Utah, USA], we calculated sample size for our primary outcome of MIDAS scores based on previous study by Voight et al (2011) comparing MIDAS scores before and after manipulation therapy. This study revealed a mean of 24.8 for the treatment group and 28.6 for the control group. In order to detect this difference, allowing for moderate sample variability, we require a minimum of 70 patients per group (N=140) for 80% power at alpha=.05. For analysis of the interim results of first ten patients enrolled, all statistical analyses were conducted in IBM SPSS for Windows Version 18. Wilcoxon signed rank test was used for the comparisons because the data was not normally distributed and there was high SD relative to the mean. P values <.05 are considered statistically significant. One of the ten patients were removed from the study due to loss of follow up with protocol treatment schedule. Each participant's severity of migraine is assessed by the level of disability determined by the MIDAS score. The MIDAS level of disability is calculated by the following scoring system: 0 to 5 - MIDAS Grade I, Little or no disability; 6 to 10 - MIDAS Grade II, Mild disability; 11 to 20 - MIDAS Grade III, Moderate disability; 21+ - MIDAS Grade IV, Severe disability. Participant demographics included 9 female and 1 male, mean age 36 +/- 7, with 4participants age 18-30 and 6 participants age 31-50. 
Results: Results of 9 participants were included for the interim analysis of this pilot study after 1 participant was withdrawn due to loss of follow up. Seven out of 9 participants had improvement in MIDAS disability grade level, which was the primary endpoint: 3 participants improved from grade IV to grade I, 2 participants from grade IV grade II, 1 participant from grade IV to grade III, and finally, 1 participant from grade II to grade I. Wilcoxon signed rank test showed OMT significantly reduced MIDAS score with a pre-treatment median score of 27.0 (severe disability, grade IV) and post-treatment median score of 5.0 (little to no disability, grade I) with a p value of 0.03. All 3 secondary endpoints were significantly reduced including HIT-6 score, pre-treatment median score of 67.00, post-treatment median 58.00 (P<.01); headache frequency over 3 month period, pre-treatment median number of days was 20.00, post-treatment median number of days was 4.00 (P<.01); and headache severity by pain score, pre-treatment median score was 8 and post-treatment median score was 6.0 (P=.04). 
Conclusion: In conclusion, we have seen statistically significant improvement in both primary and secondary endpoints for the first 9 patients to complete the treatment protocol in this pilot study. This further validates the effects of OMT on migraine headache in regard to decreased disability, severity, pain intensity and number of days with migraine and is in agreement with previous studies including Voight, et al (2011) and Cerritelli, et al (2013). At St. Luke's University Hospital, we plan to enroll 70 participants in both the intervention group and a control group not receiving OMT. We hypothesize to continue to reproduce these significant results demonstrating OMT techniques to improve the severity and disability associated with migraine headaches. Future studies with larger sample size compared with control participants not receiving OMT or sham OMT should produce similar results. 
Acknowledgement/Funding Source: Acknowledgement to the Family Medicine and Internal Medicine residents that participated in the treatment of participants: Abby Rhoads DO, Patricia Donovan DO, Bram Sakdiponephong DO, Benjamin Veres DO, Awan Rahman DO, Tess Chamakkala DO, Anthony Cianciolo DO, Max Widawski DO. Cara Ruggeri DO, Osteopathic Program Director for Internal Medicine. 
References
1. Burch R, Rizzoli P, Loder E. The Prevalence and Impact of Migraine and Severe Headache in the United States: Figures and Trends From Government Health Studies. Headache. 2018 Apr;58(4):496-505. doi:10.1111/head.13281. Epub 2018 Mar 12. 
2. Francesco Cerritelli, et al. Is osteopathic manipulative treatment effective in migraine?. International Journal of Osteopathic Medicine. March 2013Volume 16, Issue 1, Pages e1-e2. 
3. Karen Voigt. Efficacy of Osteopathic Manipulative Treatment of Female Patients with Migraine: Results of a Randomized Controlled Trial. Journal of alternative and complementary medicine (New York, N.Y.) 17(3):225-30, March 2011. 
4. Stewart W F, et al. Validity of the Migraine Disability Assessment (MIDAS) score in comparison to a diary-based measure in a population sample of migraine sufferers. Pain 2000;88(1):41-52. 
*C5—Osteopathic Philosophy
Perceptions and Awareness of Osteopathic Medicine Among Students in Other Health Professions 
Ryan Dyches, OMS IV1; Luisa D. Ruck, DO2; Amy B. Stein, PhD3; Gary C. Gailius, DO4; Kate Worden, DO4 
1Midwestern University Arizona College of Osteopathic Medicine 
2Department of Family Medicine, University of Buffalo 
3Office of Research and Sponsored Programs, Midwestern University Arizona College of Osteopathic Medicine 
4Department of Osteopathic Manipulative Medicine, Midwestern University Arizona College of Osteopathic Medicine 
Statement of Significance: Interprofessional models have better health outcomes for patients but training in the health professions often occurs in isolation, which causes health care professionals in training to remain uncertain about their responsibilities and value of their related peers. Patient centered care requires that we be at the forefront of a collaborative model, and that misconceptions about DO's scope of practice be addressed. An ideal place to approach other health professionals is during their training, as many student DOs share their campuses with other health professionals. This collaboration may facilitate communication and allow for better patient care in the future. 
Methods: Participants were recruited from the dental, podiatry, optometry, nurse anesthesia, speech/language pathology, physician assistant, occupational therapy, physical therapy, biomedical sciences, cardiovascular science, pharmacy, clinical psychology, and veterinary medical programs at Midwestern University in Glendale, AZ. Participants were required to be OMM naïve (defined as never having received or directly observed any osteopathic manipulative treatments). Students were recruited via a campus-wide email. 
The intervention was conducted on October 31st 2018 over 4 1 hour blocks. The intervention consisted of the following: 
Participants were administered an initial survey to evaluate their baseline understanding and perception of osteopathic medicine. 
Participants were then given a brief presentation regarding the background, history, training, and scope of practice of osteopathic physicians. 
Participants received an OMT demonstration consisting of 5 different techniques performed by an OMM scholar/fellow or a member of the OMM department at the Arizona College of Osteopathic Medicine. The techniques were suboccipital release, muscle energy of an anterior innominate rotation, high-velocity low-amplitude of a posterior radial head, strain-counterstrain of the trapezius, and myofascial release of the thoracic inlet. 
Following the demonstration, participants were re-administered the same survey to assess for a change in their understanding and perception of osteopathic medicine. 
Data Analysis: 43 participants (53% female, 47% male) met the inclusion criteria, attended the session and completed the surveys. Participants included students from Biomedical Sciences (28%), Dental (21%), Physician's Assistant (PA) (19%), Speech/Language Pathology (12%), Pharmacy (7%), Optometry (7%), and Clinical Psychology (2%) programs. 2 students did not identify which program they attended. A paired t test was performed on each survey question to determine changes in participants’ knowledge and perceptions of osteopathic medicine before and after the educational intervention. An independent-samples t test was also used to compare responses between male and female participants before and after the intervention. 
Subgroup analysis was performed, using ANOVA, on 3 subgroups to assess differences between professions. The 3 subgroups were: Biomedical Sciences students (many of whom will apply to osteopathic medical school); the Physician Assistant and Pharmacy students (both of whom frequently work with osteopathic physicians in hospitals and other practice settings); and all other health professions students. The 2 survey responses which did not identify programs were not included. Tukey all pairwise comparisons test was conducted on the groups post hoc. 
Results: When applied to all of the survey questions, the paired t test yielded P<.0001. There was no statistically significant difference between the before and after change in mean scores for the responses from male and female participants. The ANOVA yielded significant differences for 5 of the 11 survey questions. These questions were “I understand the difference between a DO and an M.D.” (P=.0473), “I understand the difference between an osteopathic physician and a chiropractor” (P=.0121), “I understand the difference between osteopathic manipulative treatment and chiropractic treatments” (P=.0214), “I feel comfortable explaining osteopathic medicine to another person” (P=.0297), and “OMT can reduce pain due to trauma” (P=.0136). 
The results of the Tukey all-pairwise comparisons post hoc test was as follows: 
For 1 of the statements in the survey, “I feel comfortable explaining osteopathic medicine to another person,” Biomedical Sciences students had statistically significantly more agreement than the Pharmacy/PA group (adjusted P=.0231). For the other 4 statements tested above, Biomedical Sciences students were statistically significantly higher in agreement with the statement compared with the all-other-professions group. Finally, for the statement, “I understand the difference between a DO and a Chiropractor,” Pharmacy/PA students had statistically significantly greater agreement than the all-other-professions group. 
Conclusion: Our study demonstrates that an intervention in interprofessional education during health professions training can lead to increased understanding of osteopathic medicine among health profession trainees. Compared with pre-intervention, postintervention scores were statistically significantly higher for each statement of understanding. Highest scores were achieved by professions that were more likely to work with osteopathic physicians; however though they did not have the highest mean scores, the all-other professions group had the largest average mean increase in scores. 
Limitations included the single-site setting of the study, the relatively small group size (especially for subgroup analyses) and the brevity of the intervention. The lack of a comparison group, and the absence of randomization into the intervention, are also methodological weaknesses. More research is needed to determine if the impact of this type of intervention is generalizable to other settings. Additionally, further study may determine the reason for the subgroup differences described in our study. 
This study demonstrates a brief, low-cost intervention is associated with meaningful improvements in the understanding of osteopathic medicine by an interprofessional team. However, the limitations of this study preclude making causal inferences from the results. This training may help clarify the role of osteopathic physicians as members of the health care team, and ultimately benefit their patients. 
References
1. Allen, Thomas Wesley. 2010. ‘Osteopathic physician’ defines our identity. The Journal of the American Osteopathic Association 110: 744-744. doi:10.7556/jaoa.2010.110.12.744. 
2. Gilbert, J. H., Yan, J. Hoffman, S. J.. 2010. A WHO report: framework for action on interprofessional education and collaborative practice. J Allied Health 39 Suppl 1: 196-197. 
3. Pecukonis, Edward, Doyle, Otima Bliss, Donna Leigh. 2008. Reducing barriers to interprofessional training: Promoting interprofessional cultural competence. Journal of Interprofessional Care 22: 417-428. doi:10.1080/13561820802190442. 
4. Suter, Esther, Arndt, Julia, Arthur, Nancy, Parboosingh, John, Taylor, Elizabeth, Deutschlander, Siegrid. 2009. Role understanding and effective communication as core competencies for collaborative practice. Journal of interprofessional care 23: 41-51. 
C6—Chronic Diseases and Conditions
Investigating the Interaction Between Self-Reported Measures of Pain and COMT and BDNF Polymorphisms in the Setting of Chronic Low Back Pain 
Maryam Burney, OMS III1; John Licciardone, MBA, MS, DO2; Nicole Phillips, MS, PhD3 
1University of North Texas Health Science Center 
2PRECISION Pain Research Registry, Family Medicine, University of North Texas Health Science Center 
3Institute for Healthy Aging, Microbiology, Immunology and Genetics, University of North Texas Health Science Center 
Statement of Significance: Chronic low back pain (CLBP) is now the leading cause of disability worldwide and is the second most common reason for health care visits. The etiology of CLBP is multifactorial, from molecular to psychosocial factors. Single genetic polymorphisms (SNPs) of catechol-o- methyltransferase (COMT) and brain derived neurotrophic factor (BDNF) have been shown to moderate pain outcomes. Also, certain cognitive responses of pain have been shown to amplify pain intensity. Current literature lends support to the predictive value of a bio-psychosocial model on pain outcomes. 
Methods: This cross-sectional study included 423 participants with CLBP. Over 3,500 participants were recruited from the Dallas-Fort Worth area based on criteria for the Pain Registry for Epidemiological, Clinical, and Interventional Studies and Innovation (PRECISION) at the University of North Texas Health Science Center (1). During the initial visit, participants provided biological samples for analysis and completed cognitive measures of pain, including the pain self-efficacy (PSE) and pain catastrophizing (PCS). DNA extraction and genotyping were completed by the Phillips laboratory. 
Data Analysis: Using SPSS software, a 1-way ANOVA was run for rs4680 and rs6265 genotypes (GG, AG, AA) as independent variables and the Numerical Rating Scale (NRS), PCS and PSE as dependent variables. LSD post hoc analyses were completed for the rs4680 and rs6265 genotypes that showed a statistically significant difference (P<.05). Descriptive statistics were used to determine the mean and standard errors. 
Results: One-way ANOVA showed a statistically significant difference in the rs4680 genotypes and NRS pain outcomes (P=.03). A LSD post hoc analysis of rs4680 revealed that the AG group (P=.017) had lower pain outcomes compared with the AA group. The 1-way ANOVA did not present a relationship between rs6265 genotypes and pain outcomes (P=.40). Neither pain catastrophizing nor self-efficacy were associated with rs4680 and rs6265. 
Conclusion: Results indicate that pain outcomes in rs4680 AG heterozygotes are statistically reduced when compared with AA homozygotes, the Met/Met genotype. Despite literature, there was not a strong association between the rs4680/ COMT and PCS, so a mediating effect could not be determined. Furthermore, rs4680 genotypes did not show an association to PSE. Rs6265 P values (P>.05) support the null hypothesis that is no relationship between BDNF SNPs and cognitive measures of pain and pain outcomes itself. 
A possible explanation may be that in the setting of chronic low back pain, the interaction between cognitive functions and SNPs may not be pronounced. Another possible explanation is the race and ethnic population distribution of the participants in the Dallas Fort Worth skew the representation of the rs680 genotypes. Regardless, the AG genotype of rs4680 could be a significant predictor of pain outcomes in the setting of CLBP. 
Acknowledgment/Funding Source: National Institutes of Health (NIH) BACPAC Research Program and the NIH HEAL Initiative. 
Osteopathic Research Center (6 different grants). 
References
1. Riccarton JC, Gatchel RJ, Phillips N, Aryal S. The Pain Registry for Epidemiological, Clinical, and Interventional Studies and Innovation (PRECISION): registry overview and protocol for a propensity score-matched study of opioid prescribing in patients with low back pain. J Pain Res. 2018;11:1751-1760. 
2. Vossen H, Kenis G, Rutten B, van Os J, Hermens H, Lousberg R. The genetic influence on the cortical processing of experimental pain and the moderating effect of pain status. PLoS One. 2010;5:e13641. 
3. Low I, Kuo PC, Tsai CL, Liu YH, Lin MW, et. al. Interactions of BDNF Val66Met 
4. Martinez-Calderon J, Zamora-Campos C, Navarro-Ledesma S, Luque-Suarez A. The Role of Self-Efficacy on the Prognosis of Chronic Musculoskeletal Pain: A SystematicReview. J Pain. 2018 Jan;19(1):10-34. 
5. Tavitz J, Solms M, Ramesar R. The molecular genetics of cognition: dopamine, COMT and BDNF. Genes Brain Behav. 2006 Jun;5(4):311-28. 
*C7—Impact of Osteopathic Manipulative Medicine (OMM) and Osteopathic Manipulative Treatment (OMT)
OMT as Wellness in the Family Medicine Residency 
Eileen Conaway, DO1; Arlene O'Donnell, DO1; Melissa Pena, BA2; Julie Pepe, PhD3; Yuan Du, MS3 
1AdventHealth Family Medicine Residency at East Orlando 
2AdventHealth Volunteer 
3AdventHealth Center for Collaborative Research 
Statement of Significance: AdventHealth Family Medicine Residency at East Orlando is ACGME accredited with Osteopathic Recognition. As ACGME's Clinical Learning Environment Review (CLER) Pathways to Excellence and Common Program Requirements stress the need for resident wellness and burnout prevention, the residency sought to fulfill this mandate with an osteopathic solution. If regularly receiving OMT could improve resident mental health, then this program could be easily implemented for osteopathic residents of any specialty across the country. There has been some limited research on the effect of OMT on mental health parameters in the general population, but only 1 study to date on its effect in the osteopathic profession itself with first year medical students. 
Research Methods: Residents in the AdventHealth Family Medicine Residency at East Orlando were eligible to participate. All residents were required to take part in the wellness program, but their participation in the research arm was voluntary. The study was IRB approved by AdventHealth IRB #900172 and was exempted from written informed consent. The Residency has an academic half-day 1 afternoon per week for educational lectures. Seven 1-hour lecture time slots per year spaced throughout the academic year were designated as OMT wellness times. Portable OMT tables were set up and residents were given an hour to exchange a full osteopathic evaluation and treatment with a fellow resident. Faculty board certified in either Neuromusculoskeletal Medicine (NMM), Family Medicine and Osteopathic Manipulation, or both, as well as fourth year Integrated FM/NMM residents were present to assist as needed with evaluation and treatment. Every effort was made to treat any residents who were not present within 2 weeks of the scheduled OMT wellness session. A series of validated National Institutes of Health PROMIS Health Measures were collected quarterly from the residents in an anonymous fashion. These measures assessed: anxiety, depression, fatigue, sleep, emotional support, and alcohol use. Each resident was assigned a randomly generated participant number to allow for the linking of anonymous responses. Data collected began in August 2016 and conclude June 2019. 
Data Analysis: Data analysis was performed by a professional bio-statistician. Data from the NIH Promise Measures were analyzed for change over time as well as compared with normative values established during their validation. Wilcoxon signed rank test was used to assess the difference between the initial and final values. The study was designed to run for 3 full academic years. In the third year of the project the Graduate Medical Education department for the hospital system rolled out their own required residency wellness program. This was determined to be too large of a con-founder for this study and therefore data from the 3rd year of the study was not included in the analysis. 
Results: Data was analyzed from 23 residents from the first year of the study and the 16 residents who remained in the residency during the 2nd year of the study. During the first year, participants showed significant improvement in symptoms of anxiety (P=.009), fatigue (P=.043), and depression (P=.008). When residents were compared with normative values at the end of the first year there was positive difference in symptoms of anxiety (=P=.004) and depression (P=.001). Resident fatigue was worse than the normative value but not significantly so, but sleep disturbance was significantly worse than normative value (=P=.010). Residents displayed significantly higher levels of emotional support (=P=.001) and lower levels alcohol consumption than normative values (P=.001). Secondary analysis was performed to assess for effect of age, sex, marital status, or presence of children. Secondary analysis was also performed to investigate any difference between residents who were currently on or had recently complete a more demanding rotation vs rotations with a more routine work load. There was no significant difference in any of the sub group analyses. The second year in the study showed a maintenance of these improvements with no significant worsening. 
Conclusion: Exchanging OMT treatments may be a viable component to a residency wellness program. It results in improvement in reported symptoms of anxiety, depression, and fatigue, all of which can be signs of burnout. It does not mitigate the sleep disturbance that is inherent in residency programs due to fluctuating schedule and work demands. It has the added anecdotal benefit of allowing residents a low stress environment to practice OMT without the time constraints of a patient care clinic. The program requires minimal time, effort, and equipment to institute and can be used by any specialty. It is also a practical application for osteopathic principles and practice that can help a program meet requirements for osteopathic recognition. 
Acknowledgement/Funding Source: The portable OMT tables used for this study were funded by the East Orlando Osteopathic Foundation. 
Other researchers on this study included: Kamini Geer, MD, Brian Browning, DO, Steven Gallas, DO, Hyrum Brodniak, DO, Travis Gordon, DO, Randal Davis, DO, Bradley Janhke, DO. 
References
1. Accreditation Council for Graduate Medical Education. CLER Pathways to Excellence: Expectations for an optimal clinical learning environment to achieve safe and high quality patient care. ACGME 2014 and Common Program Requirements. ACGME 2016. 
2. Ader DN. Developing the Patient-Reported Outcomes Measurement Information System (PROMIS). MedCare. 2007; 45(5S1)S1-S2 
3. Brennan J, McGrady A. Designing and implementing a resiliency program for family medicine residents. Int J Psychiatry Med. 2015; 50(1)104-111. 
4. Ripp JA, Fallar R, Korenstein D. A Randomized Controlled Trial to Decrease Job Burnout in First-Year Internal Medicine Residents Using a Facilitated Discussion Group Intervention. J Grad Med Educ. 2016; 256-259. 
5. Wiegand S, Bianchi W, Quinn TA, et. al. Osteopathic Manipulative Treatment for Self-Reported Fatigue, Stress, and Depression in First-Year Osteopathic Medical Students. J Am Osteopathic Assoc. 2015;115(2):84-93. doi:10:7556/jaoa.2015019. 
C8—Chronic Diseases and Conditions
Exploring Unintended Pregnancy Among Women With Opiate Dependence 
Kelley Jean Fields Harmon, DO1; Nancy Fischer, 2; Maggie S. White, 3; Meghan May, MS, PhD4; Caroline O. LaFave, DO2; Stephen A. Samantha, OMSIV4 
1Maine-Dartmouth Family Medicine Residency 
2Maine Dartmouth Family Medicine Residency Program 
3Colby College 
4University of New England College of Osteopathic Medicine 
Statement of Significance: Of infants born in Maine in 2015, 995 of ∼12,400 births were substance exposed, representing 8% of births and requiring longer hospital stays adding significant financial and social cost to Maine. Among female opiate users, contraception use is low, and 87% of births are unplanned. Other factors, including tobacco use and mental health disorders, are also associated with opiate use in pregnancy. Understanding trends can help us promote planned pregnancy, which could reduce health care costs and promote improved outcomes for mothers and children. From an osteopathic perspective, this study will inform our approach to patients struggling with opiate use disorder by addressing the mind, body and spirit. (See references below.) 
Methods: This is an IRB approved retrospective study involving a medical record review of Maine-Dartmouth Family Practice (MDFP) and Family Medicine Institute (FMI) patients. The study is designed to collect baseline data on unintended pregnancy in women diagnosed with opiate use disorder to lay the groundwork for future interventions with this population and provide education for both health care professionals and patients. All female patients between age 18 and 40 who received care at MDFP or FMI and had a confirmed pregnancy between Jan 1, 2013 and Dec 31, 2015 were identified. Variables are described below. Primary medical record reviews were conducted by third and fourth-year medical students from University of New England College of Osteopathic Medicine, undergraduate students at Colby College, and family medicine residents at Maine-Dartmouth Family Medicine Residency Program. Secondary reviews were conducted by a senior family medicine resident and an attending family medicine physician to ensure data integrity. 
Data Analysis: χ2 analysis was performed to explore associations between the variables of interest and determine statistical significance. We are exploring the intentionality of pregnancy stratified by the following variables: 1. Age; 2. Opiate dependence; 3. Engagement in MAT (Medication Assisted Treatment); 4. Type of active treatment (buprenorphine vs methadone); 5. Payer type (as proxy for income level: federal/self-pay/commercial); 6. Gravidity/Parity; 7. Presence/absence of co-occurring mental health; 8. Practice Location; 9. Pregnancy Outcome. A preliminary analysis of 250 medical records (69 opiate-dependent, 181 non-opiate-dependent) has been conducted to date. 
Results: In a preliminary sample of 250 medical records chosen at random from the full data set, a significantly higher proportion of pregnancies among opiate dependent women were unplanned than among women without opiate dependence (55% opiate dependent vs 36% non-opiate dependent with P<.002). In addition to this primary result, the sample was analyzed with regard to secondary results, including any differences among women with opiate dependence who received opiate dependent care vs those who did not receive care, as well as any differences in use of other substances, mental health diagnoses, and pregnancy outcomes. Among women with opiate dependence, those who were not in opiate dependent care were more likely to have an unplanned pregnancy (P<.02). A comparison of the population of women with opiate dependence to their peers without this diagnosis also showed a significantly higher rate of tobacco use among women with opiate dependence (63% in opiate dependent vs 31% non-opiate dependent). Additionally, women with opiate dependence were significantly more likely to have a diagnosis of anxiety (59% in opiate dependent vs 31% non-opiate dependent). Lastly, there was no statistically significant difference in pregnancy outcome among the cases analyzed in this sample. 
Conclusion: Preliminary results from a sample of 250 medical records suggest that unplanned pregnancy in our patient population is more likely among women with opiate dependence as compared with their peers without this diagnosis. Additionally, initial data analysis suggests differences in pregnancy intentionality among women with opiate dependence in opiate dependent care and those not receiving care. While the data suggest higher rates of anxiety among women with opiate dependence, analysis of the full data set is necessary to confirm a link between opiate dependence and mental health diagnoses. Analysis of the full data set is incomplete, so final conclusions cannot be drawn at this time noting that observations may change and further study is warranted. 
References
1. Maine Department of Health and Human Services Office of Substance Abuse and Mental Health Services. Substance Abuse Trends in Maine: State Epidemiological Profile 2014. South Portland, ME: Hornby Zeller Associates, Inc. Available from: http://www.maine.gov/dhhs/samhs/osa/pubs/data/2014/SA_Trends_2014.pdf 
2. Sutter MB, Leeman L, His A. Neonatal opioid withdrawal syndrome. National Center for Biotechnology Information. U.S. National Library of Medicine, 2014. 
3. Hall KS, Jones HE, Arria A, et al. Unintended pregnancy in opioid-abusing women. Journal of Substance Abuse Treatment. 2011; 40(2): 199-202. Available from: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3052960/ 
4. Patrick SW, Faherty LJ, Dick AW, Scott TA, Dudley J, Stein BD. Association among county-level economic factors, clinician supply, metropolitan or rural location, and Neonatal Abstinence Syndrome. JAMA. 2019; 321(4): 385-93. 
*C9—Osteopathic Philosophy
Medical Professional Students’ Perceived Impact of Opioid Addiction on Healthcare Professions 
Sophia Catherine Mort, OMS III1; Elizabeth A. Beverly, PhD2 
1Ohio University Heritage College of Osteopathic Medicine 
2Department of Family Medicine, Ohio University Heritage College of Osteopathic Medicine 
Statement of Significance: The opioid crisis is a severe and pervasive public health issue in the United States, and medical providers are frequently faced with new challenges associated with opioid misuse. In order to retain the health care workforce and prevent burnout, it may be helpful to understand the perspectives of students regarding opioids and addiction. Previous studies have useused experiential educational interventions to improve knowledge and attitudes about addiction. However, there is limited research on the opioid-related exposures that medical professional students already experience during training. Understanding the baseline perspectives of students will inform inter-professional educational interventions with the goal of improving patient care. 
Methods: The study was approved by Ohio University's Institutional Review Board (protocol number 18-E-195). A cross-sectional survey study of 510 medical professional students (i.e. NP, PA, and DO students) at Ohio University was conducted between April 23 and May 22, 2018. Participants were eligible for the study if they were enrolled as a student in Ohio University's Nurse Practitioner program, Physician Assistant program, or Heritage College of Osteopathic Medicine during the duration of the survey window. All responses were anonymous and recorded electronically. Participants completed a brief demographic profile and the Opioid Impact, Beliefs, and Experiences survey, which included an open-ended short answer question asking students to reflect on the impact of opioid addiction on their profession. The Opioid Impact, Beliefs, and Experiences survey was developed by an inter-professional team of experts in medical education at Ohio University. The survey was reviewed and exploratory factor analysis was performed to establish validity. 
Data Analysis: Participants were removed from analyses if they did not provide a response to the short answer question, resulting in a final sample of 451 participants. Short answer responses were analyzed via qualitative content and thematic analyses. Recurring concepts within and across responses were identified as themes which described participants' experiences and beliefs regarding the impact of opioid addiction on their profession. 
Results: Of the 451 participants who completed the open-ended short answer question, most were DO students (69.4% DO students; 62.1% female, mean age=27.2±5.6 years, 80.2% Caucasian, 57.4% plan to work in primary care, 52.5% grew up in area with a population ≤50,000). Qualitative analysis revealed 3 themes: 1) Opioid addiction severely impacts health care professions: Students stated that the opioid crisis was severe and there were an increasing number of patients becoming addicted. Thus, participants reported seeing overdoses and patients in active withdrawal while on their clinical rotations. 2) The opioid crisis acts as a barrier to providing quality health care: Students described increasingly restrictive opioid prescribing regulations, and they noticed that providers had difficulty managing workflow interruptions due to the high number of overdoses. 3) There is a physical and emotional impact on providers: Students expressed fear of prescribing opioids in the future, even when medically appropriate, because of potential patient harm and subsequent legal repercussions. Increased stress was noted among participants, and several witnessed patients threatening or injuring health care providers. 
Conclusion: Medical professional students were exposed to opioid-related experiences during their clinical training, and most felt that opioid addiction has had a severe impact on their respective health care profession. The opioid crisis has presented the health care community with new challenges in patient management and emergency care, and these challenges should be addressed to improve, not only patient outcomes, but also providers’ job satisfaction. Further analysis should be conducted to compare results across academic programs to determine if experiences are similar or if certain health care professions are more affected than others. Additionally, semi-structured, in-depth qualitative interviews could provide more details to understand the impact of opioid addiction on providers. Limitations of the current study include the cross-sectional design, which cannot capture changes in perception over time. Although 3 different academic programs are included in the current study, the data are collected from 1 academic institution in Ohio, which limits the generalizability of findings to other programs. 
Acknowledgment/Funding Source: This research was funded, in part, by the Osteopathic Heritage Foundations (OHF) Vision 2020 Grant. 
*C10—Osteopathic Philosophy
Exploring Substance Use in Medical School and Its Effect on Student Academic Performance 
Ryan Margolin, OMS III1; Abigail K. Bailey, OMS III2; Kathleen M. Daddario-DiCaprio, PhD3; Christine M. Lomiguen, MD4 
1Touro College of Osteopathic Medicine (New York) 
2Department of Primary Care, Touro College of Osteopathic Medicine 
3Department of Basic Sciences, Touro College of Osteopathic Medicine 
4Department of Pathology, Lake Erie College of Osteopathic Medicine 
Statement of Significance: Substance use for enhanced academic performance and mental well-being among medical students is a widely-held view with limited evidence-based literature. It is well-established that high stress and emotional demand of medical school have led to reported burnout. While previous research has been conducted looking at substance use prevalence, it was concluded that more data were needed on substance use habits of medical students. Further, with the increasing number of osteopathic medical schools and the rigorous course load that accompanies their curricula, students may resort to such measures to gain a competitive edge. 
Methods: A voluntary anonymous survey was distributed to 3rd and 4th year medical students to gather data regarding frequency of use of various substances (classified below), both recreationally and for academic enhancement, as well as COMLEX-USA Level 1 and USMLE Step 1 scores and cumulative GPA. An email was sent to all students in the surveyed classes containing the link to the survey. Anonymity was stressed multiple times in the email and cover letter. The survey was done and analyzed using Qualtric software. Institutional Review Board (IRB) approval was obtained prior to survey distribution. 
Substances tested were as followed: Stimulants included were caffeine pills, cocaine, prescription stimulants (Adderall, Ritalin, etc), and Tobacco. Depressants included were: alcohol, marijuana, and prescription opioids (Vicodin, Codeine, etc.). Students also had the option to fill in "other" and the class was determined appropriately. 
Data Analysis: Data were assessed for statistical significance using a two-tailed student t test with a P<.05. The data consisted of GPAs for the class of 2020 and 2021, and COMLEX-USA Level 1 and USMLE Step 1 scores from the class of 2020. Based on the preliminary data, the N value was sufficient to establish statistical significance in some, but not all categories, thus prompting increased data collection at this time. 
Results: It was established that in users of substances for the purpose of studying, stimulant use decreased COMLEX-USA scores, USMLE scores, and GPA by an average of 21, 8, and 0.16, respectively; depressant use decreased COMLEX, USMLE, and GPA by 11, 7, and 0.12 points, respectively. For recreational substance users, it was found that stimulant use decreased COMLEX, USMLE, and GPA by an average of 5, 3, and 0.19 points, respectively; depressant use decreased COMLEX, USMLE, and GPA by an average of 12, 3, and 0.14 points, respectively. It was further established that the prevalence of recreational stimulant and depressant use is 35.4% and 77.2%, respectively; the prevalence of stimulant and depressant use as a study aid prior to medical school while studying is 27.85% and 15.19%, respectively; and the prevalence of stimulant and depressant use as a study aid during medical school is 31.6% and 17.72%, respectively. 
Further data are currently being collected from the class of 2022 now that they have GPAs, and the class of 2021 is being reevaluated to collect their board examination scores. 
Conclusion: Analysis of survey results revealed that recreational substance use in medical school is associated with a statistically significant decrease in academic performance, as indicated by GPA. Additionally, students who admitted to substance use as a study aid before medical school had statistically significant lower GPAs compared with students who were substance-free. In conclusion, based on our preliminary findings, substance use does not correlate with a positive effect on academic performance. This is in contrast to the common belief that substances can be used to enhance academic outcomes. This notion is exhibited by our data on drug use prevalence, which indicates more students use stimulants to study during medical school than beforehand. Further studies are currently being conducted on a larger cohort to investigate a wider-spread effect of substance use as a study aid during medical school, and also to explore our tertiary objective and deduce whether the primary motivation is performance enhancement, or other intentions. 
References
1. Dyrbye, L. N., Thomas, M. R., Huntington, J. L., Lawson, K. L., Novotny, P. J., Sloan, J. A., Shanafelt, T. D. (2006). Personal life events and medical student burnout: a multicenter study. Academic Medicine, 81(4), 374-384. 
2. Gundersen, L. (2001). Physician burnout. Annals of Internal Medicine, 135(2), 145-148. 
3. Dumitrascu, C., et al. Substance Use Among Physicians and Medical Students. Medical Student Research Journal, 2014. Winter (3). 026-035. 
4. MacLean, L., Booza, J., Balon, R. (2016). The Impact of Medical School on Student Mental Health. Academic Psychiatry, 40(1), 89-91. 
★*C11—Musculoskeletal Injuries and Prevention
Effect of Subconcussive Events on ImPACT Scores of Men's Collegiate Lacrosse Players 
Katherine Keever, OMS II; Matthew T. Geiselmann, OMS II; Taesung Kim, OMS II; Caroline Varlotta, OMS IV; Brandon Burg, OMS III; Joseph Miceli, OMS III; Hallie Zwibel, O; Matthew Heller 
NYIT Center for Sports Medicine, New York Institute of Technology College of Osteopathic Medicine 
Statement of Significance: Head injuries are of particular importance in young athletes, who are still developing regions of their brain into their twenties (4). Decreases in cognitive function can occur with each additional concussion, along with a prolonged recovery period and increased anxiety and depression (5, 6). 
Using a widely implemented screening tool, such as ImPACT, coaches and physicians can recognize warning signs that an athlete is at risk for injury. Monitoring these subconcussive events, their effect on an athlete's physical and mental well-being, and being able to correctly assess progression, will allow physicians to take a holistic approach to the athlete's care in regards to body, mind and spirit, and guide osteopathic treatment methods. 
Methods: 17 athletes on the NCAA Division II Collegiate Men's Lacrosse were enrolled prior to starting their season (January - June). Immediate PostConcussive Assessment and Cognitive Testing (ImPACT) was used for neurocognitive testing, and impacts were measured with Athlete Intelligence Cue Sports Helmet sensors containing accelerometers. All participation was voluntary, and each participant provided informed consent under approved IRB protocol BHS-1304. Recruitment was done via NYIT physicians and students in conjunction with the NYIT Athletic Director. Participants were randomly assigned an ID number to ensure data collection anonymity, and were instructed to wear their sensors during practices and 18 games. Each hit and its magnitude were automatically transmitted to the AI server via Bluetooth. ImPACT testing was conducted at 3 different points (pre-, mid-, and postseason), and additionally by team physicians if a concussion occurred. 
Data Analysis: ImPACT uses 6 different tests that evaluate word recognition, design memory, visual processing and memory, and working memory/visual response speed. Five different composite scores are produced from these results: verbal memory, visual verbal memory, reaction time, visual motor speed, impulse control, and cognitive efficiency index (7). In each of the 5 composite scores, the change over the pre-, mid-, and postseasons was tested using the repeated measures analysis of variance. For those composite scores with significant changes, a posthoc analysis was performed for pairwise comparison with the pre-season as a reference. Statistical significance was evaluated with α=0.05. 
Results: The average verbal memory decreased from 84.1 at pre-season to 79.3 at mid-season and 73.7 at postseason (P=.008), with a difference in score of 10.4 between the pre-season and postseason testing (P=.017). The average visual memory scores decreased from 79.0 at pre-season to 73.6 at mid-season and 62.3 at postseason (P<.001), with a difference in score of 5.4 between the pre-season and postseason testing (P=.001). No other composite scores from ImPACT testing were statistically significant, nor were impacts recorded by accelerometers or the ImPACT clinical symptoms questionnaire. 
Conclusion: ImPACT scores for verbal and visual memory decreased throughout the lacrosse season, supporting our hypothesis and previous results in our laboratory. The decreases could not be correlated with the number of impacts each athlete sustained, possibly due to issues with compliance among the athletes as the sensor had to be switched between 2 helmets throughout the season. Future directions of this project include determining a more reliable method to measure impacts, and obtaining a larger sample size to examine if any correlations present among positions. 
Acknowledgment/Funding Source: I would like to thank Dr Matthew Heller and Dr Hallie Zwibel for the opportunity to work on this project, in addition to Dr Min-Kyung Jung, PhD for performing the statistical analysis, as well as OMS II Simon Katz for his assistance with data collection. Funding for this study came from the NYIT In-House Grant. 
References
1. Pavlov V, et. al. Mild traumatic brain injury in the United States: demographics, brain imaging procedures, health-care utilization and costs. Brain Injury (2019). 
2. Comeau D, et al. Diagnosis of concussion on the sidelines. Semin Pediatr Neurol (2019). 
3. Talavage TM, et al. Functionally-detected cognitive impairment in high school football players without clinically-diagnosed concussion. J Neurotrauma (2014). 
4. Miller DJ, et al. Prolonged myelination in human neocortical evolution. Proc Natl Acad Sci USA (2012). 
5. Taylor K, et al. Concussion history and cognitive function in a large cohort of adolescent athletes. AM J Sports Medicine (2018). 
6. McAllister T, et al. Long-term cognitive and neuropsychiatric consequences of repetitive concussion and head-impact exposure. J Athl Train (2017). 
7. Faltus J, et al. Utilization of ImPACT testing to measure injury risk in alpine ski and snowboard athletes. Int J Sports Phys Ther (2016). 
*C12—Osteopathic Philosophy
Relationship Between Demographic Factors and AACOM Cultural Competencies on Global Seminar Students 
Jocelyn Canedo, OMS II1; Jocelyn S. Canedo, OMS II2; Etienne J. Hinojosa, MPH3; Maria J. Lopez, MD4; Zaira Alvarado, MD5; Ana Lebrón, MD6; Alba Beltre, MD7; Sandra Gomez, PhD8; Gabriela Estrada, MD9; Dean Sutphin, PhD10 
1Edward Via College of Osteopathic Medicine (Auburn Campus) 
2International Outreach, Edward Via College of Osteopathic Medicine (Auburn Campus) 
3Research and Evaluation for International Programs, Edward Via College of Osteopathic Medicine (Auburn Campus) 
10Vice Provost for International and Appalachian Outreach, Edward Via College of Osteopathic Medicine (Auburn Campus) 
Statement of Significance: VCOM provides a Global Health Seminar that implements a “constructivist” cognitive approach in providing students with experience in cultural competency. The course utilizes a curriculum of case-studies, forum discussions, interviews with medical school faculty, and interactive video conferences across medical schools in the U.S., Caribbean, and Central America. 
Research Methods: The research study was conducted in collaboration with 6 medical schools, 3 US VCOM campuses (Virginia, South Carolina, and Alabama) and 3 medical schools in Honduras, El Salvador, and Dominican Republic. The study population of 85 participants was recruited from the students currently enrolled in the Global Seminar at each of the participating campuses. Inclusion requirements were the same as for enrollment in the course: 1) English-speaking 2) self-selected application and 3) approved by school Dean or committee. The data was collected using a 61-item Qualtrics self-assessment survey separated in 2 sections, General Background Information and AACOM General and Cultural Competencies, using a 10-point Likert scale (1=None, 10=Very High). Instrument validity was established by a panel of experts. 
Data Analysis: The average for certain factors were take, as well as a One-way ANOVA to be able to test for significance. 
Results: The overall mean for General Competencies was 6.52 and the overall mean for Cultural Competencies was 6.40. Both scales were additionally analyzed independently in comparison to 4 demographic factors - Gender, Age, Ethnicity, and Place of Residence. 
A One-way ANOVA was performed to test for significance (α=.05) between General Competencies and Ethnicity (P=.87) and Place of Residence (P=.25), and Cultural Competencies with Ethnicity (P=.012) and Place of Residence (P=.008). 
Conclusion: In the tests performed examining the relationship between demographic factors and general or cultural competencies, only the relationships between cultural competencies and ethnicity and cultural competencies with place of residence showed statistical significance. These results show that there is a difference in the self-assessment of cultural competencies between ethnicities among medical students enrolled in this course. Similarly, the results also show a difference in self-assessed cultural competencies by place of residence among medical students. Further research is needed to examine which ethnic groups and from which country display higher self-assessed cultural competencies. 
These results will be followed up by a post-course self-assessment examining if participation in the Global Seminar reduces the differences in cultural competencies between the demographic groups and if cultural competencies improve overall. 
*C13—Impact of Osteopathic Manipulative Medicine (OMM) and Osteopathic Manipulative Treatment (OMT)
The Effect of Facial Effleurage on Acute Rhinosinusitis 
Jillian Helena Bradley, PhD; Chelsea J. Weidman, MS 
Edward Via College of Osteopathic Medicine (South Carolina) 
Statement of Significance: Physicians prescribe antibiotics to 85-98% of patients presenting with rhinosinusitis, even though 90-98% of the patients with rhinosinusitis would spontaneously resolve without intervention. Physicians are aware of this growing issue; however, due to patient expectations, the physicians still prescribe antibiotics. Facial Effleurage (FE) might allow physicians an avenue to directly help patients without prescribing antibiotics. While many Osteopathic physicians express anecdotal evidence of the therapeutic power of FE, there exists a substantial lack of scientifically based explorations into the efficacy of FE. Providing evidence to support the use of FE is critical to encourage physicians to utilize this Osteopathic Manipulative Therapy. 
Research Methods: This study design is a parallel-arm, randomized, placebo-controlled clinical trial evaluating the efficacy of Facial Effleurage. Patients presenting to 2 outpatient, direct primary care clinics in a mid-sized manufacturing town are asked to participate. After informed consent is given, the patient is screened for enrollment. Samples of the nasal mucus secretions, WBCs, serum, and bacterial nasal swab are collected. Patients answer surveys asking the patient how bad their current symptoms are. Then, patients are randomized into 1 of 8treatment groups. Facial Effleurage treatment is administered by a board-certified Osteopathic physician. The Physical Touch Control Protocol attempts to address the placebo effect without allowing true Osteopathic Manipulation to be performed. The antibiotic treatment is a prescription of antibiotics, usually amoxicillin, as determined by the physician. One hour after the beginning of treatment, the patients provide the samples listed above. Then the patients record the severity of their symptoms every 12 hours for the next 7 days. The patients report to the clinic for a follow-up appointment. The samples are taken, and the patient is asked about adverse events, and the resolution of symptoms. 
Data Analysis: Serum cytokine and antibody levels are measured by ELISA. Mucosal cytokine levels are measured by cytometric bead array. Bacterial pathogen isolation is performed on a swab of the middle turbinate, and growth on various selective agars and biochemical tests are performed for the identification of species. A power analysis revealed that a sample size of 40 is needed for the minimal effect needed. Descriptive statistics, 2-tailed Fisher Exact Tests, ANOVA analysis, were performed using GraphPad Prism software as needed. P<.05 was considered significant. 
Results: So far, 86/200 patients have been enrolled in our study. Facial Effleurage significantly decreases the patient-reported symptom severity 1 hour after treatment and at the follow-up appointment 7 days after treatment. Patients receiving the sham treatment did not report significant decreases in symptom severity, nor did patients who only received antibiotics. Serum levels of total IgG and total IgE are significantly decreased 1 hour after treatment. Serum levels of IL-6 are significantly decreased 1 hour after treatment and that decrease continues 7 days after treatment. Serum levels of TNF-a are significantly increased 1 hour after treatment. 
Conclusion: Our data suggest that Facial Effleurage has a significant benefit in decreasing the severity of symptoms for patients suffering from acute rhinosinusitis. This benefit seems to be uniquely associated with the methods during facial effleurage and not patient expectations or placebo effect as this benefit was not consistently found in patients treated with the sham treatment. The benefit of facial effleurage is also not only associated with patient-reported symptoms but is also found in immunological parameters like cytokines, white blood cells, antibodies, complement proteins, and other effector molecules. This suggests that facial effleurage has the ability to remove any obstruction to the nasal tissues, refreshes the immunological environment within the tissues, allows for the effective removal of any pathogens, and causes the healing of the symptoms of acute rhinosinusitis. 
Acknowledgement/Funding Source: This work was funded by the American Osteopathic Association (Grant number 2031815722). Pilot data collected for this project was funded by The Edward Via College of Osteopathic Medicine (VCOM). We would like to thank the staff at Palmetto Proactive Healthcare for helping with blood collection and the Research Administration at VCOM for helping us with IRB approval and grant submission to support this work. 
References
1 Gonzales, R. Decreasing Antibiotic Use in Ambulatory Practice. Jama 281, 1512 (1999). 
2 Smith, S. S., Kern, R. C., Chandra, R. K., Tan, B. K. & Evans, C. T. Variations in antibiotic prescribing of acute rhinosinusitis in united states ambulatory settings. in Otolaryngology - Head and Neck Surgery (United States) 148, 852-859 (2013). 
3 Schappert SM & Burt CW. Vital and Health Statistics Series 13, No, 159 (02/06). (2001). 
4 Garbutt, J. M., Banister, C., Spitznagel, E. & Piccirillo, J. F. Amoxicillin for Acute Rhinosinusitis. Jama 307, 685 (2012). 
*C14—Pain Management
The Effect of OMM on Opioid Users with Chronic Low Back Pain 
Kishan Patel, OMS III1; Danielle L. Cooley, DO2; James W. Bailey, DO2; Deanna M. Janora, MD2; Catherine Fusco, DO2 
1Rowan University School of Osteopathic Medicine 
2NeuroMusculoskeletal Institute, Rowan University School of Osteopathic Medicine 
Statement of Significance: Since chronic pain is sustained by noxious sensory input originating in the musculoskeletal system, it becomes a major target for osteopathic practices. OMM may provide the balance that these patients seek between advanced interventions and patient-centered care, to reduce costs and make safer opioid therapy decisions. Previous studies have explored the use of complementary and alternative medicine (CAM) therapies, and other studies have shown an association between OMM and circulatory pain biomarkers, such as the endogenous opioid system by β-endorphin (βE). However, any significant association of these changes to a therapeutic effect from OMM remains speculative, due to the lack of large sample sizes and controlled prospective designs. 
Methods: IRB approval was granted for this project (Pro #: 2018002374). In this randomized controlled trial, we approached 273 patients at the NeuroMusculoskeletal Institute in Stratford, New Jersey, who were on opioid therapy for chronic low back pain; overall, 95 patients initially enrolled in the study: treatment group=55, control group=40. The participants were randomized into 2 groups: the treatment group (OMM treatment + opioid therapy) and control group (opioid therapy). After participant attrition, there were a total of 55 participants who completed the study: treatment group=24, control group=31. The OMM treatment modalities consisted of the following: soft tissue, muscle energy (ME), myofascial release (MFR), balanced ligamentous tension (BLT), and counterstrain (CS). To assess the effectiveness of the treatment, patients in both groups filled out 2 forms after each visit, approximately every 4-6 weeks for 3-6 months. The Wong-Baker FACES Pain Rating Scale evaluated the intensity of pain, with scores from 0 to 10. The Pain and Disability Questionnaire (PDQ) measured the disability caused by pain with 2 components: the functional (max score 90) and the psychosocial component (max score 60), for a maximum score of 150 (highest disability). Data from the electronic medical records (EMRs) and New Jersey medical prescription (NJRx) database helped identify and track opioid usage in milligram morphine equivalents (MME) throughout the protocol. 
Data Analysis: Analysis included paired t tests measuring the pre-study vs poststudy values for the following dependent variables: PDQ functional component, PDQ psychosocial component, FACES pain scale, and MME dosages. t tests analyzed the data in the treatment group and control group independently; the correlation, degrees of freedom, and P value (significance level of .05) were recorded in each respective group. Possible age and gender effects were tested for and did not contribute any significant variance in either group. 
Results: Paired t tests in the treatment group indicated that there was a trend for decreases in both the PDQ psychosocial component and the FACES pain scale during pre-study vs poststudy, with P values of .05 and .04 respectively. PDQ psychosocial values changed from 45.0 +/- 13.2 to 40.7 +/- 14.7. FACES pain scale values changed from 7.0 +/- 1.7 to 5.75 +/- 2.33. In addition, there was a decreasing trend in the PDQ functional scores for the control group with a P=.03. PDQ functional values changed from 62.5 +/- 17.5 to 59.5 +/- 18.0. There were no significant changes in the MME dosages in either group. 
Conclusion: The overall results show that OMM intervention may have an impact on the patients’ pain and psychosocial health, due to its hands-on approach and emotional impact. Because there were a high number of patients unable to complete the study in the treatment group, the impact of OMM on physical functioning could not significantly be concluded. Additionally, there needs to be a more effective way to measure the patients’ medication intake in a controlled manner. Physicians can incorporate subjective feedback on pill count and frequency during each encounter, rather than solely an objective MME analysis from the medical prescription database. Suggestions for future research include using OMM intervention every 2 weeks over a longer period of time (6 months), substituting the PDQ with the Roland-Morris Disability questionnaire for low back pain, and adding a poststudy survey for patient feedback. 
Acknowledgment/Funding Source: Thank you to Dr Robert A. Steer for the support and generous advice with the statistical analysis. 
This work was funded by the Summer Medical Research Fellowship Program (SMRF) and supported by the Neuromusculoskeletal Institute (NMI). 
References
1. Jerome JA. An Osteopathic Approach to Chronic Pain Management. J Am Osteopath Assoc 2017;117(5):306-314. doi:10.7556/jaoa.2017.056 
2. Smith, J.B., Ridpath, Lance, Steele, K.M.. (2012). A research protocol to determine if OMM is effective in decreasing pain in chronic pain patients and decreasing opioid use: Brief report. AAO Journal. 22. 38-45. 
3. Kuchera ML. Osteopathic Manipulative Medicine Considerations in Patients With Chronic Pain. J Am Osteopath Assoc 2005;105(suppl_4):S29-S36. 
4. Degenhardt BF, Darmani NA, Johnson JC, Towns LC, J. Rhodes DC, Trinh C, McClanahan B, DiMarzo V. Role of Osteopathic Manipulative Treatment in Altering Pain Biomarkers: A Pilot Study. J Am Osteopath Assoc 2007;107(9):387-400. 
5. Anagnostis C, et al: The Pain Disability Questionnaire: A New Psychometrically Sound Measure for Chronic Musculoskeletal Disorders. Spine 2004; 29 (20): 2290-2302 
★*C15—Chronic Diseases and Conditions
Does a Single Bout of Rock Steady Boxing Improve Procedural Memory? 
Karthik Bola Kamath, OMS II1; Vyshnavi P. Kodali, OMS-II2; Courteney E. Olenyk, OMS II2; Christina M. Roselli, OMS II2; Atif Ghaffar, OMS III2; Rosemary Gallagher, PT, DPT, PhD, GCS1; Adena N. Leder, DO, FAAN1 
1New York Institute of Technology College of Osteopathic Medicine 
2Department of Osteopathic Manipulative Medicine, New York Institute of Technology College of Osteopathic Medicine 
3Department of Physical Therapy, New York Institute of Technology School of Health Professions 
Statement of Significance: In the United States, nearly 1 million people will be diagnosed with PD by the year 2020. Procedural memory is impaired with the progression of the disease. While acute high-intensity aerobic exercise shows a positive effect on procedural learning in people with PD, current literature does not address whether these effects extend to RSB, a popular form of exercise for people with PD. Osteopathic philosophy states that each person is a unit of body, mind, and spirit. Rock Steady Boxing addresses these domains by incorporating exercise (body), engagement of cognitive processes (mind), and social interaction (spirit). This study focused on potential improvements in memory (mind) with RSB as a means to improve the lives of people with PD. 
Research Methods: This IRB approved study used purposive sampling to recruit 7 participants from the RSB program at the New York Institute of Technology College of Osteopathic Medicine. Inclusion: diagnosis of PD, ages 40-85, stage I-IV (Hoehn and Yahr scale). Exclusion: Montreal Cognitive Assessment Score (MoCA) < 20, prior head injury, stroke, atypical PD. The Unified Parkinson Disease Rating Scale (UPDRS) Part III Motor subscale, the Patient Health Questionnaire (PHQ-9), a measure of depression, and the 9 Hole Peg Test for upper extremity motor dexterity, were used to describe participants. Using a modified SRTT to test procedural memory, participants viewed a computer display showing a visual stimulus repeatedly appearing in 1 of 4 locations. The task utilized 7 blocks of random or ordered sequences with a 30-second interval between each block. Participants indicated the location of the visual stimulus by pressing 1 of several buttons on a response board. A familiarization session of the SRTT was performed on Day 1 to orient participants to the task. The SRTT was then preceded either by rest or a 10-minute bout of high intensity aerobic exercise (RSB), followed by a 24-hour retention test. Conditions were counterbalanced between participants. Participants were tested at peak medication dose. 
Data Analysis: Mean reaction time in milliseconds while performing the SRTT task was the primary outcome. A 1-way ANOVA with repeated measures was conducted to determine if there was a difference in reaction time between trials. Paired t tests were conducted to determine if an acute bout of exercise resulted in a faster reaction time compared with no exercise, and secondly, to determine if an acute bout of exercise improved reaction time for the exercise retention test compared with the no exercise retention test. Results were processed by the Millisecond Software © Inquisit 5 Lab, a computer-based psychological testing program. Statistical analysis was performed using IBM © SPSS Version 23. Means and SDs were calculated for RPM with an alpha level of .05. 
Results: A significant decrease within (F=5.989, P<.000) and between (F=307.078, p<.000) participants was found when comparing reaction times for each trial. No difference was found in reaction time between the post exercise and rest conditions for immediate or retention tests. 
Conclusion: Although a significant decrease in reaction time was found trial to trial, within and between participants, a difference in reaction time with an acute bout of aerobic exercise during an RSB class compared with a no exercise condition was not found, demonstrating no residual effect of RSB on procedural memory. These results may be due to the small sample size and large variability in reaction times found in these participants. In this study, a holistic approach, one which follows the Osteopathic philosophy, was applied to people with PD who participated in an RSB program thus cultivating a sense of community (spirit) with other people with PD. The sense of community, together with the physical and cognitive aspects of the class, has the potential to have a positive effect on memory (mind). Future studies should include a larger sample size to determine if there are indeed positive effects on procedural learning with RSB. 
Acknowledgement/Funding Source: We thank the New York Institute of Technology College of Osteopathic Medicine for use of the facilities in the Wellness Gym and W. Kenneth Riland Academic Health Care Center. We would also like to thank Rock Steady Boxing head coach, David Patton and Wellness Center Coordinator, Amanda Braadt for their assistance with this study. Lastly, we would like to thank Christopher K. McLeod, OMS III, for launching the procedural memory pilot study at NYITCOM in 2018, of which this study is based on. 
References
1. Clark, G. M., Lum, J. A., & Ullman, M. T. (2014). A meta-analysis and meta-regression of serial reaction time task performance in Parkinson's disease. Neuropsychology, 28(6), 945. 
2. Combs, S., Diehl, M., Chrzastowski, C., Didrick, N., McCoin, B., Mox, N., Staples, W., & Wayman, J. (2013). Community-based group exercise for persons with Parkinson disease: a randomized controlled trial. NeuroRehabilitation, 32(1), 117-124. 
3. Mang, C. S., Snow, N. J., Wadden, K. P., Campbell, K. L., & Boyd, L. A. (2016). High-Intensity Aerobic Exercise Enhances Motor Memory Retrieval. Medicine and science in sports and exercise, 48(12), 2477-2486. 
4. Muslimovic´, D., Post, B., Speelman, J. D., & Schmand, B. (2007). Motor procedural learning in Parkinson's disease. Brain, 130(11), 2887-2897. 
5. Robertson, E. M. (2007). The serial reaction time task: implicit motor skill learning?. Journal of Neuroscience, 27(38), 10073-10075. 
*C16—Musculoskeletal Injuries and Prevention
Using the King Devick Test as a Measure of Changes in Neurocognitive Decline in Collegiate Men's Lacrosse Athletes 
Taesung Kim, OMS II1; Katherine M. Keever, OMS II2; Matthew T. Geiselmann, OMS II2; Caroline Varlotta, OMS IV2; Joseph Miceli, OMS III2; Brandon Burg, OMS III2; Matthew Heller, DO3; Hallie Zwibel, DO3 
1New York Institute of Technology College of Osteopathic Medicine 
2Department of Osteopthic Medicine, New York Institute of Technology College of Osteopathic Medicine 
3Center for Sports Medicine, Department of Osteopathic Medicine, New York Institute of Technology College of Osteopathic Medicine 
Statement of Significance: The goal of this study is to explore methods of detecting athletes at risk of cerebral impairment caused by subconcussive and concussive impacts. The human brain is arguably the most important structure of the human body and as a result it is important to be able to recognize and manage the earliest signs of cognitive impairments. The central nervous system is a critical component of the mind, body, and spirit model. As students of Osteopathy, it is important to understand that when the mind is damaged the human experience will suffer. In the case of collegiate athletes, impairments to brain function will not only not only affect performance on the field, but performance in the classroom as well. 
Methods: The King Devick test has been previously shown to be an accurate and reliable method for identifying athletes with head trauma and is considered a strong candidate to be used as a rapid sideline screening test for concussions. The test is based on measurement of the speed of rapid number naming, and captures dysfunction of eye movements, attention and other correlates of suboptimal brain function as a result of a concussive event (1). There are 3 cards, each subsequent card is more difficult than the previous. The participant will read the numbers out loud to a test administrator, who will record time to complete each card in seconds (s) and number of errors. 
The test was administered to 17 NYIT NCAA Division II Men's Lacrosse athletes over the course of the sports season (i.e. pre, mid, and postseason). Participation was voluntary and recruitment was done by research personnel. Athletes who volunteered in the study were enrolled under approved IRB protocol BHS-1304. Participants were asked to read the lines of numbers as fast as they could without making an error. The scores from the 3 cards were summed together to produce a composite measure for their entire test and compared through seasons. 
Data Analysis: Data were analyzed by comparing the scores from the King Devick test of each athlete from pre-season, mid-season and postseason using the repeated measures analysis of variance followed by the pairwise comparisons with the pre-season as a reference. Statistical significance was evaluated with α=.05. 
Results: The King Devick test composite scores significantly changed over the 3 seasons (P=.005). From pre-season to mid-season, the total time to complete the King-Devick task significantly decreased by 4.8s (P=.002) and from pre-season to postseason by 3.7s (P=.019). For Card 1, the average decrease in time to complete the task was 13.2s in pre-season, 11.3s in mid-season, and 11.8s in postseason (P=.009). For Card 2, the average decrease in time to complete the task was 12.8s in pre-season, 11.4s in mid-season, and 11.7s in postseason (0.008). There were no significant changes in errors made during each task in pre-, mid- or postseason. 
Conclusion: Even though the results from this study did not support our hypothesis that the scores on each card would worsen from the pre-season to postseason, we are able to draw possible conclusions about the utility of King-Devick in the context of subconcussive impacts in Men's Collegiate Lacrosse. The improvements in King Devick test scores, as seen in King Devick card 1 and 2 can most likely be explained by a learning effect, as seen in previous studies assessing test-retest reliability (4). Card 3 may be too challenging to exhibit and statistically significant results. King-Devick is a statistically validated concussion test, but may not be an appropriate test to use repeatedly, even when tests are spread out by several weeks. In addition, the King Devick test is normally used as an immediate postevent concussion screening test, however, its use as an indicator of subconcussive impairment could be limited. 
Acknowledgment/Funding Source: I would like to give special thanks to Dr Zwibel and Dr Heller for their help on guiding this project. I would also like to thank Dr Min-Kyung Jung, Ph.D for performing the statistical analysis, as well as OMS II Simon Katz for his assistance with data collection. Funding for this study was provided by the NYIT In-House Grant. 
References
1. Galetta KM, et al, The King-Devick test and sports-related concussion: Study of a rapid visual screening tool in a a collegiate cohort, J Neurol Sci (2011), doi:10.1016/j.jns.2011.07.039 
2. Marmar M, McIlvain NM, Fields SK, Comstock RD. Epidemiology of concussions among United States high school athletes in 20 sports. AM J Sports Med. 2012 Apr;40(4):747-55. doi:10.1177/0363546511435626 
3. Talavage TM, Nauman EA, Breedlove EL, Yoruk U, Dye AE, Morigaki K, Feuer H, Leverenz LJ. Functionally-Detected Cognitive Impairment in High School Football Players Without Clinically-Diagnosed Concussion. J Neurotrauma. 2014 Feb 15;31(4):327-38. doi:10.1089/neu.2010.1512 
4. Oberlander TJ, Olson BL, Weidauer L. Test-Retest Reliability of the King-Devick Test in an Adolescent Population. J Athl Train. 2017;52(5):439-445. doi:10.4085/1062-6050-52.2.12 
★*C17—Musculoskeletal Injuries and Prevention
Absence of Cervical Spine Pain on Musculoskeletal Examination in Cervical Spine Fractures: An Analysis of Elderly Trauma Patients at a Level I Trauma Center 
Jason Blake, OMS III1; Sarah K. Spilman, MA2; Nicholas H. Kluesner, MD3; Chase N. Deobald, DO3; Carlos A. Pelaez, MD2 
1Des Moines University College of Osteopathic Medicine 
2Trauma Surgery, The Iowa Clinic 
3Emergency Medicine Department, UnityPoint Health 
Statement of Significance: Incidence of c-spine injury is 3 times higher in older adults compared with younger cohorts. Published clinical management guidelines (Canadian C-Spine Rule and the National Emergency X-Radiography Utilization Study) are regularly used to determine the need for computed tomography (CT) imaging of the c-spine, and one of the key inclusion criteria for both guidelines is the presence or absence of neck pain. While the guidelines may have appropriate specificity and sensitivity across the age spectrum, previous research has found that more than 20% of older trauma patients with c-spine fracture did not report the pain or tenderness components of somatic dysfunction on initial musculoskeletal examination. 
Research Methods: A retrospective study was performed at a Level I adult trauma center in the Midwest. Ethical approval for the study was obtained from the hospital's Institutional Review Board. The trauma registry was used to identify patients 55 years and older who presented to the hospital with blunt injury during the study period (April 2017 - December 2018). Patients were excluded from analysis if the Glasgow Coma Scale (GCS) was less than 14 at the time of clinical examination or if the patient had baseline dementia. Chart review of the electronic medical record was conducted for data not included in the trauma registry. The study design predetermined that 64-99 patients with c-spine fractures were required in order to detect a moderate effect size with a power of 0.80. Patients were considered “pain-free” if they did not complain of c-spine pain and denied tenderness to palpation of the c-spine on initial musculoskeletal examination prior to CT imaging of the neck. 
Data Analysis: All analyses were performed with IBM SPSS Basic Statistics for Windows, version 20.0 (IBM Corp, 2011). Descriptive statistics were examined and reported for continuous data as medians and interquartile ranges; categorical data were reported as counts and percentages. All statistical tests were 2-tailed and based on a 0.05 significance level. Because data were not normally distributed and sample sizes were unequal, differences between medians were assessed using the Kruskal-Wallis 1-way analysis of variance. Differences between nominal variables were assessed using the χ2 test. 
Results: In the study period, 1,212 patients met inclusion criteria. Twenty-one percent of patients (n=260) reported c-spine pain and 89% of them (n=232) received a c-spine CT scan. Twenty-seven percent (n=63) of scanned patients with neck pain were found to have a c-spine fracture. Conversely, 79% of patients (n=952) did not report c-spine pain and 40% of these patients (n=380) received CT imaging of the c-spine. 4 percent (n=17) of the scanned patients who did not report neck pain were found to have a c-spine fracture. Overall, incidence of c-spine fracture was 13% (80 of 612 patients who received a CT of the neck). Seventeen of the 80 patients (21%) with a c-spine fracture did not report pain on the initial examination, and neck pain was not significantly associated with patient sex (r=0.00, p=.99), age (r=-.19, p=.09), degenerative joint disease (r=0.09, p=.41), or injury severity score (r=-0.02, p=.84). More than one-third of patients (n=31) had a c-spine fracture at multiple levels and 84% of these patients reported neck pain on initial examination. None of the asymptomatic patients required an operative procedure, while twenty-one percent (n=63) of symptomatic patients did. Lastly, among patients who were transported by EMS, 86% of patients with a c-spine fracture were wearing a cervical collar at the time of arrival to the hospital. However, 4 of 14 patients without neck pain and 6 of 58 patients with neck pain did not have a cervical collar placed prior to arrival. 
Conclusion: Study findings indicate that 13% of elderly patients who received a CT of the neck had a cervical spine fracture, and 21% of elderly patients with a cervical spine fracture did not report neck pain on initial examination. The absence of neck pain cannot be used to definitively rule out c-spine fractures in this population and is an insufficient criterion for identifying which patients should receive c-spine CT imaging. Additionally, there were no detectable patterns to identify which patient or injury characteristics predicted asymptomatic cervical fractures. While none of the pain-free fractures required an operative procedure, clinical intervention was still recommended in most cases as 15 of the 17 patients were discharged from the hospital in a c-collar or brace. Cervical spine fracture is a relatively uncommon injury, therefore study findings are limited by the small number of patients with c-spine fractures. This prevented the study team from detecting any important characteristics of patients with c-spine fracture who did not report neck pain on examination. The study is also limited by its retrospective nature and limited documentation of neck pain in the medical record, especially for patients transferred from outside facilities. 
*C18—Chronic Diseases and Conditions
Ocular Scatter Index and Scheimpflug Imaging as a Measurement for Prediabetes: An Interdisciplinary Case Control Study 
Alison Shuff, OMS II1; Madison F. Smith, 1; George Asimellis, PhD2; Brittany M. Martin, OD-12 
1University of Pikeville Kentucky College of Osteopathic Medicine 
2Kentucky College of Optometry, University of Pikeville Kentucky College of Osteopathic Medicine 
Statement of Significance: In Kentucky, there are over 3,200 youth diabetes cases being covered by Medicaid and Kentucky Employees’ Health Plan alone (The Cabinet for Health and Family Services and Kentucky Personnel Cabinet, 2017). An early diagnosis of pre-diabetes can lead to earlier lifestyle or pharmacological treatments to reverse the effects before diabetes has fully developed. With the rate of youth diagnoses on the rise, it is important to establish an early detection tool. This study will potentially provide an avenue for early detection in youth populations through measurement of ocular scatter, enabling optometrists to provide early detection screening during comprehensive eye examinations. 
Research Methods: The study enrolled 60 eyes from 60 individuals with a mean age of 35.7 years. Participants were recruited using a flyer that was distributed around the city of Pikeville. The study was conducted among Appalachian residents. Two groups were formed, based on the threshold of HbA1c; affected group A (n=28) was formed of individuals with HbA1c ≥ 5.7% (39 mmol/mol) and non-affected group B (n=32) of individuals with HbA1c < 5.7%. HbA1c was associated via linear regression with the following ocular indisposition measurements provided by the HD Analyzer/Optical Quality Analysis System (OQAS), based on double pass aberrometry: Ocular Scatter Index (OSI), an objective measure of forward light scatter and aberrations, and digital break-up time, based on stability of the Strehl ratio of the three-dimension point spread function (PSF). In addition associations were sought with central corneal thickness, anterior chamber depth, and lens thickness measure with the Pentacam HD, which uses Scheimpflug imaging. 
Data Analysis: Multiple linear regression model, paired t test and confidence analysis was run between OSI and HbA1c level and between OSI and tear break-up time (TBUT). 
Results: The affected group A had statistically significant difference (decreased) anterior chamber depth (P=.0706), increased corneal thickness (P=.095), increased lens thickness (P>.01), and increased ocular scatter (P=.05) in comparison to the non-affected group B. OSI was higher in the affected group A (2.25, interquartile range = 1.3 - 3.2) than in the control group B (1.65; interquartile range = 0.7 - 1.2; P=.017). In a multiple linear regression model, OSI was identified as the most influential variable on light scatter (mean ratio = -1.02; P=.003; 95% CI = -1.025 to -1.005). Correlation between OSI and HbA1c level was positive (r=0.51, P=.045) in the affected group; no statistically significant correlation with OSI was observed for non-invasive TBUT. 
Conclusion: This study indicates elevated ocular scatter during elevated hyperglycemia in early diabetes. Increased ocular scatter could be associated with the temporary increases in corneal and lenticular thickness and clarity. It appears that diabetes affects light scatter more than other possible predisposition. 
Acknowledgement/Funding Source: Funding was provided by the University of Pikeville Kentucky College of Optometry. 
References
1. The Cabinet for Health and Family Services and Kentucky Personnel Cabinet. (2017). Kentucky Diabetes Report. Frankfort, KY. 
*C19—Pain Management
Clinically Meaningful Improvements in Hand Osteoarthritis Pain With Diclofenac Sodium Gel 1% 
John Howell Peniston, DO1; Florilene Bouisset, MSC2; Amy Kenneally, PharmD3; Roy Altman, MD4 
1GlaxoSmith Kline Consumer Health Care 
2Department of Biostatistics and Data Management, GlaxoSmith Kline Consumer Health Care 
3Department of Medical Affairs, GlaxoSmith Kline Consumer Health Care 
4Department of Rheumatology, University of California 
Statement of Significance: Topical non-steroidal anti-inflammatory drugs (NSAIDs) or capsaicin are recommended by the American College of Rheumatology (Hochberg MC, et al. Arthritis Care Res. 2012;64:465-474) for the treatment of patients with hand osteoarthritis (OA). Diclofenac sodium gel 1% (DSG 1%), a topical NSAID, demonstrated significant improvements relative to placebo in the signs and symptoms of hand OA in a randomized clinical trial. Most patients treated with DSG 1% achieved clinically meaningful relief within 1 week that was sustained for ≥8 weeks. 
Research Methods: This study was an 8-week, prospective, randomized, double-blind, multicenter, parallel group study that compared DSG 1% with placebo in participants with OA of the hands. MCII responders were defined as having relative improvement of ≥15% over baseline in Australian/Canadian Index (AUSCAN) total, pain, function, and stiffness, and on pain intensity, based on findings defined by Bellamy et al. (Arthritis Care Res (Hoboken). 2015;67(7):972-80). 
Data Analysis: The percentage of responders was analyzed using logistic regression with treatment and hand OA category included in the model. Time to MCII response was analyzed using the log-rank test stratified by hand OA category. 
Results: This analysis included 198 patients treated with DSG 1% and 187 treated with placebo. Significant differences in the percentage of patients reaching an MCII were evident at Week 1 (DSG 1% vs placebo, odds ratio [95% confidence limits]): pain intensity, 65.2% vs 52.4%, OR 1.70 [1.12, 2.56], P=.012; AUSCAN total, 57.1% vs 44.4%, OR 1.66 [1.11, 2.49], P=.014; AUSCAN pain, 59.1% vs 48.7%, OR 1.53 [1.02, 2.30], P=.039; AUSCAN function, 53.5% vs 42.8%, OR 1.55 [1.03, 2.32], P=.034; AUSCAN stiffness, 58.1% vs 44.4%, OR 1.75 [1.17, 2.63], P=.007, and at both Weeks 4 and 6 (primary time points), apart from AUSCAN pain at Week 4 and AUSCAN stiffness at Week 6. For AUSCAN pain and AUSCAN stiffness, a significantly higher percentage of DSG 1% treated patients had a response at both Week 4 and 6 when a ≥30% relative improvement criteria was used. Mean time to first MCII response was lower with DSG 1% relative to placebo for all measures: pain intensity, 15.9 vs 24.2 days, P=.021; AUSCAN total, 18.6 vs 28.4 days, P=.001; AUSCAN pain, 18.5 vs 26.4 days, P=.013; AUSCAN function, 21.8 vs 30.2 days, P=.001; AUSCAN stiffness, 22.5 vs 29.3 days, P=.004. The percentage of patients with an MCII response seen at Week 1 was sustained to Week 8 within the DSG 1% group for all endpoints. 
Conclusion: The MCII is a relevant measure for studies of patients with OA because it considers patient perspectives on clinical improvements. In this analysis, this criterion was applied to data from a previously published clinical trial of patients with OA of the hand for the first time. Most patients treated with DSG 1% achieved clinically meaningful relief within 1 week that was sustained for ≥8 weeks. Despite placebo response rates of 44% to 52%, a significantly higher percentage of patients had MCII responses with DSG 1%, providing evidence for the efficacy of DSG. 
Acknowledgement/Funding Source: This study was funded by GlaxoSmithKline Consumer Healthcare. 
References
1. Hochberg MC, et al. American College of Rheumatology 2012 recommendations for the use of nonpharmacologic and pharmacologic therapies in osteoarthritis of the hand, hip, and knee. Arthritis Care Res (Hoboken). 2012;64(4):465-474. 
2. Bellamy N, et al. Development of multinational definitions of minimal clinically important improvement and patient acceptable symptomatic state in osteoarthritis. Arthritis Care Res (Hoboken). 2015 Jul;67(7):972-980. 
*C20—Pain Management
A Novel Approach in the Management of Post-Episiotomy Pain 
Yisroel Grabie, OMS II1; Zara Jamil, OMS II1; Joseph Schwob, OMS II1; Boris Petrikovsky, MD, PhD1; Arkady Uryash, MD, PhD1 
1New York Institute of Technology College of Osteopathic Medicine 
2Garden OB/GYN 
3Mount Sinai Medical Center 
Statement of Significance: The first tenet of osteopathic medicine states: “The body is a unit the person is a unit of body, mind, and spirit.” Given that childbirth is a traumatic event for the mother, in addition to the fact that postpartum depression rates are considerable, it seems valuable to explore novel pain management resources using the osteopathic holistic philosophy for the treatment of postepisiotomy pain. It is our belief that in treating a mother's perineal pain, we may also improve her overall mind and spirit enhancing her wellbeing. 
Methods: This pilot study was conducted in an outpatient obstetrics clinic located in Miami, F.L. involving postpartum women between the ages of 18-39 years of age, who underwent vaginal delivery with episiotomy. Spray bottles with the investigational product were distributed to the patients to manage their pain freely without regulation. A survey to assess postepisiotomy pain using the Visual Analog Scale (VAS) was administered to the patients. Pain attenuation, time to pain attenuation, and quality of pain were measured 
Data Analysis: Analysis of this preliminary study indicates that Relivatrol© significantly reduced postepisiotomy pain. We are currently in the process of replicating this study on a larger scale in order to address limitations inherent to the study's design. 
Results: The cohort consisted of 25 postpartum women. Of note, there were 5 women who did not respond to the treatment. The investigational product attenuated pain by an average of 3.2 scale units. Additionally, in a subgroup analysis of the “responders”, pain was attenuated by 4.0 scale units. Pre-administration pain quality was reported as sharp (n=12), achy (n=6), and dull (n=5). In the participants who responded to treatment, the average time to analgesia was reported to be 9.25 Average pain ratings after treatment were compared with average pain ratings before treatment using a unidirectional paired sample t test (df=24). The average pain ratings for the entire cohort (including non-responders) after administration of Relivatrol© were significantly lower than average pain rating prior to administration t(24)=7.41, P<.0001. 
Conclusion: We concluded that Relivatrol© significantly decreases postepisiotomy pain. Since this pilot study had multiple limitations, we developed a protocol for a larger investigation involving a greater number of participants, a control arm, pharmacokinetic parameters, and an analysis of quality of life impact. 
Acknowledgment/Funding Source: None reported. 
References
1. Friedman AM, Ananth CV, Prendergast E, D'Alton ME, Wright JD. Variation in and Factors Associated With Use of Episiotomy. Jama. 2015;313(2):197. doi:10.1001/jama.2014.14774. 
2. Tsuchiya H. Anesthetic Agents of Plant Origin: A Review of Phytochemicals with Anesthetic Activity. Molecules. 2017;22(8):1369. doi:10.3390/molecules22081369. 
3. DiGiovanna EL, Schiowitz S, Dowling DJ. An Osteopathic Approach to Diagnosis and Treatment. Philadelphia, PA: Lippincott Williams and Wilkins; 2005. 
4. Hieger MA, Afeld JL, Cumpston KL, Wills BK. Topical Benzocaine and Methemoglobinemia American Journal of Therapeutics. 2017; 24(5):e596-e598.American journal of therapeutics. 2017;24:e596. 
C21—Osteopathic Philosophy
Patient Perceptions of Osteopathic Treatment Distinction 
Walter Hartwig, PhD1; Glenn E. Davis, MS2; Adam J. McTighe, PsyD3; Richard B. Riemer, DO1 
1Touro University College of Osteopathic Medicine (California) 
2Academic Affairs, Touro University College of Osteopathic Medicine 
3Georgia Department of Behavioral Health and Developmental Disabilities 
Statement of Significance: Patients can and do identify a distinctive experience of osteopathic philosophy following a clinic appointment. A framework of osteopathic distinction centered on patient experience of osteopathic philosophy and further comprising satisfaction with the visit and experience of physician empathy could be used in future studies of patient compliance and health outcomes. Demonstrating positive patient outcomes directly associated with an osteopathic approach to their care establishes a tangible distinction of osteopathic principles and practices in the training of physicians. 
Methods: Between 2017-2018 patients in 4 outpatient primary care clinics in California and Nevada were surveyed after a physician encounter. Over 2400 patients participated in the live, self-directed, anonymous and confidential survey consisting of 24 items validated to measure physician adherence to osteopathic philosophy, patient satisfaction, and physician empathy, as well as demographic information. The survey language was calibrated for a patient community readership and free of jargon. Patients participated in the survey voluntarily, affirmed a statement of informed consent, and were not compensated. Survey project managers followed a script for engaging with participants, did not assist participants in answering any of the questions, and were not given incentives to secure participants. Patients were treated by osteopathic physicians, allopathic physicians and mid-level providers at the clinic sites. Inclusion criteria included patient age of 18-80 and non-pediatric purpose of visit. The survey instrument and research grant proposal were approved by the Touro University California Institutional Research Board. 
Data Analysis: Data were analyzed using Multiple Analysis of Variance (MANOVA),Multiple Analysis of Covariance (MANCOVA), correlation, and tabulation. Relationships among dependent variables were assessed using MANOVA. A threshold of P<.01 was used to establish statistical significance. Partial eta squared (partial η2) was calculated to indicate the effect size of group differences, accounting for error variance. Values of partial η2 between 0.06 and 0.14 were considered to indicate medium effect sizes while those >=0.14 were considered to indicate large effects. The directions of relationships among dependent variables were studied using Pearson correlations. The relationships among dependent variables controlling for the effects of co-variables were studied using MANCOVA. Statistical significance and effect sizes were evaluated as in MANOVA. 
Results: Patients who experienced greater adherence to osteopathic philosophy by their physician reported higher levels of satisfaction and experiences of physician empathy compared with those who experienced lesser adherence to osteopathic philosophy. Most respondents were aged 41 to 70 [1425/2432, 59%], were female [1572/2432, 65%], and were seeing their doctor for the third time or more [1479/2432, 61%]. There was a statistically significant difference in empathy and satisfaction ratings based on experience of osteopathic philosophy. A between-subjects test showed a statistically significant difference with large effect size in experience of physician empathy based on experience of osteopathic philosophy. A second between-subjects test showed a statistically significant difference with medium effect size in satisfaction ratings based on experience of osteopathic philosophy during the visit. Positive correlations were demonstrated between patient satisfaction and experience of osteopathic philosophy, between patient satisfaction and experience of physician empathy, and between experiences of physician empathy and osteopathic philosophy. There was a statistically significant difference with small effect size in empathy ratings based on age, and no significant difference in empathy ratings based on gender. A borderline statistically significant difference with small effect size was also found in satisfaction ratings based on age but not based on gender. 
Conclusion: The survey results indicate greater patient experience of osteopathic philosophy is associated with greater patient perception of physician empathy and satisfaction with the visit. Correlation analysis confirmed the relationships are statistically significant and positive. Further analysis confirmed that the effect of experiencing osteopathic philosophy on both experience of physician empathy and satisfaction with the visit is statistically significant, even when controlling for age, gender, and visit history of the respondent. These results suggest patients in the study perceive a distinctive experience of physician empathy and satisfaction with their visit based on the experience of osteopathic philosophy, that satisfaction with their visit increases with greater experience of osteopathic philosophy and physician empathy, and that increased experience of osteopathic philosophy is related to increased experience of physician empathy. 
Acknowledgment/Funding Source: This research project was funded by the American Osteopathic Association (Grant #211630707). We thank Susan Elliott, Lou Van Der Ree, Chandra Char, Amity Buchner, Lisa Meeks, Dr Michael Clearfied, Dr John Dougherty, Dr Stacey Pierce-Talsma and the staffs at each of the 4 research sites for their contributions and assistance on this project. 
*C22—Pain Management
The Osteopathic Approach to Chronic Pain Management: Assessing Its Biopsychosocial Processes and Relationships to Clinical Outcomes 
John C. Licciardone, DO, MS, MBA; Annie Lin, OMS II 
University of North Texas Health Science Center-Texas College of Osteopathic Medicine 
Statement of Significance: Chronic low back pain is a common symptom responsible for primary care visits and a major cause of disability. The osteopathic approach to chronic pain management is thought to be distinctively based on osteopathic principles. These include: (1) the human being is a dynamic unit of function; (2) the body possesses self-regulatory mechanisms that are self-healing in nature; (3) structure and function are interrelated at all levels; and (4) rational treatment is based on these principles [1]. Such principles are highly congruent with the biopsychosocial model of pain. This study will assess how aspects of the biopsychosocial model may be manifested in differences between patients with chronic low back pain who are treated by DOs or MDs. 
Research Methods: A total of 345 patients were selected for study from the Pain Registry for Epidemiological, Clinical, and Interventional Studies and Innovation (PRECISION Pain Research Registry) at the University of North Texas Health Science Center from April 2016 through April 2019. A comprehensive overview of the registry, including procedures for collection of patient-reported data and biological specimens, has been published elsewhere [2]. The Dallas-Fort Worth metroplex of over 7 million persons served as the catchment area for the registry during this period. Patient selection criteria included: (1) being 21 to 79 years of age; (2) having chronic low back pain according to criteria established by the National Institutes of Health Task Force on Research Standards for Chronic Low Back Pain [3]; (3) having sufficient English fluency to respond to study research instruments; and (4) having the same physician for low back pain care for at least 1 year. Patients were excluded if they reported being pregnant or institutionalized. Current use of NSAIDs and opioids was assessed at the baseline visit. The Pain Catastrophizing Scale (PCS) [4] and Pain Self-Efficacy Questionnaire (PSEQ) [5] were also administered to patients at this visit. The research protocol was approved by the North Texas Regional Institutional Review Board (#2015-169). All eligible patients provided written informed consent prior to enrolling in the registry and participating in the study. 
Data Analysis: Differences in the frequency of use of NSAIDs or opioids in patients treated by DOs or MDs were assessed using contingency table methods, including odds ratios (ORs) and 95% CIs (CIs). The underlying distributions of PCS and PSEQ measures were examined for adherence to the assumption of normality using the Kolmogorov-Smirnov test. Differences between patients treated by DOs or MDs were then tested with the Student's t test or Mann-Whitney U-test as appropriate. Statistical analyses were performed with the IBM SPSS Statistics software (version 23, Armonk, NY). All hypotheses were tested at the 0.05 level of statistical significance using 2-sided alternatives. 
Results: A total of 100 (29.0%) patients were treated by DOs. There were no significant differences in age, gender, race, ethnicity, educational level, employment status, or legal claims relating to low back pain between patients treated by DOs or MDs. Among patients treated by DOs, 57 (57.0%) and 25 (25.0%) used NSAIDs or opioids, respectively, as compared with 168 (68.6%) and 91 (37.1%) among patients treated by MDs. Thus, patients treated by DOs were significantly less likely to use NSAIDs (OR, 0.61; 95% CI, 0.38-0.98; P=04) or opioids (OR, 0.56; 95% CI, 0.33-0.95; P=.03). Neither PCS (P<.001) nor PSEQ (P=0.01) measures were normally distributed. Patients treated by DOs reported significantly lower pain catastrophizing scores than patients treated by MDs (median PCS score, 8; IQR, 4-22 for DOs vs median PCS score, 16; IQR, 8-29 for MDs) (P=.001). Patients treated by DOs also reported greater pain self-efficacy scores than patients treated by MDs (median PSEQ score, 40; IQR, 27-50 for DOs vs median PSEQ score, 35; IQR, 23-45 for MDs) (P=.049). 
Conclusion: This study found that DOs were significantly less likely than MDs to prescribe NSAIDs or opioids for their patients with chronic low back pain. These findings are generally consistent with previous research [6-7], and now suggest that DOs more closely adhere to current clinical practice guidelines for treatment of chronic pain [8], including low back pain [9]. These findings may also reflect principles of osteopathic medicine, such as self-regulation and self-healing, which enable DOs to more often use non-pharmacological treatments such as osteopathic manipulative treatment to address structure and function before considering pharmacological treatments. Patients treated by DOs also reported lower levels of pain catastrophizing and greater pain-self efficacy. The latter findings suggest that osteopathic philosophy and practice are closely aligned with the biopsychosocial model of pain that considers not only local pathology in developing a treatment plan, but that also addresses psychological and social aspects of the patient's overall experience and environment to help optimize medical care. Additional research is being conducted by us to determine if better pain and functioning outcomes are reported over 6 months of follow-up by patients treated by DOs as compared with patients treated by MDs and, if so, to identify factors associated with osteopathic medical care that may be related to such better outcomes. 
Acknowledgement/Funding Source: This study was supported in part by grants to Dr. Licciardone from the Osteopathic Heritage Foundation and the American Osteopathic Association (#751711713). The authors thank the staff of the PRECISION Pain Research Registry and the study patients for their contributions to this study. 
References
1. Seffinger MA, Hruby RJ, Rogers FJ, Willard FH, Licciardone J, Jones JM, King HH. In Foundations of Osteopathic Medicine: Philosophy, Science, Clinical Applications, and Research, 4th ed; Seffinger MA, Ed. Wolters Kluwer: Philadelphia, PA, 2018:2-18. 
2. Licciardone JC, Gatchel RJ, Phillips N, Aryal S. J Pain Res 2018, 11:1751-1760. 
3. Deyo RA, Dworkin SF, Amtmann D, Andersson G, Borenstein D, Carragee E, et. al. J Pain 2014, 15:569-585. 
4. Sullivan MJ. The Pain Catastrophizing Scale: User Manual. McGill University: Montreal, QC, 2009. 
5. Nicholas MK. Eur J Pain 2007, 11:153-163. 
6. Licciardone JC. Osteopath Med Prim Care 2008, 2:11. 
7. Licciardone JC. J Am Osteopath Assoc 2015, 115:704-713. 
8. Dowell D, Haegerich TM, Chou R. MMWR Recomm Rep 2016, 65 (No. RR-1):1-49. 
9. Qaseem A, Wilt TJ, McLean RM, Forciea MA, Clinical Guidelines Committee of the American College of Physicians. Ann Intern Med 2017, 166:514-530. 
*C23—Osteopathic Philosophy
Lean Body Mass, Body Fat and Physical Activity in Esport Players Compared to Non-Esport Players 
Kyle Yuen, OMS II1; Tamzid Hassan, OMS II1; Sophia Ahmad, OMS II1; Hallie Zwibel, DO2; Joanne Donoghue, PhD3 
1New York Institute of Technology College of Osteopathic Medicine 
2Department of Family Medicine, New York Institute of Technology College of Osteopathic Medicine 
3Department of Osteopathic Manipulative Medicine, Center for eSports Medicine, New York Institute of Technology College of Osteopathic Medicine 
Statement of Significance: This study investigated body composition and activity levels in collegiate eSport players compared with their age-matched controls. The importance of investigating body composition and activity levels in a more sedentary population can be tied back to the osteopathic tenets of the inter-relationship between structure and function, as well as the body being a unit. For example, prolonged periods of being sedentary can affect one's posture if one is not aware of it, which may lead to somatic dysfunctions elsewhere in the body with additional physical and muscular stresses to compensate these dysfunctions. 
Methods: This project was approved by the New York Institute of Technology Internal Review Board. 21 male participants signed written consent to be in this study. Eleven competitive collegiate eSport players (age 20.2 ± 1.7), and ten age matched controls (age 19.2 ± 1.3) from the same college campus who were not eSport players or gamers participated. Inclusion criteria: 1. Women or men 18-30 years of age 2. A member of the NYIT eSport team if not acting as a control. Exclusion Criteria: 1. Any contraindication to have a DXA scan performed based on the American College of Radiology's practice guidelines. 
Body Composition All participants underwent body composition testing on a GE™ Lunar dual-energy absorptiometry machine (Lunar™ I-Dexa General Electric, Atlanta, GA) at NYIT. This machine analyzes whole body composition including total mass, lean mass, fat mass, fat percent and visceral fat. The machine also has the ability for individual region analysis such as for the individual legs or the trunk. Activity and Sleep Daily activity was monitored for 7 consecutive days 24 hours a day by a Fitbit Charge™. The Fitbit™ activity monitor is a quantitative tool to assess steps per day/week, calories, exercise, sleep duration and quality of sleep. The Fitbit™ uses sensors to track heart rate, activity, steps, and sleep. The monitor was placed on the non-dominant wrist of each participant and eSport players were asked to remove the watch while they were gaming to avoid false movement readings. 
Data Analysis: Data were analyzed using SPSS v25. ANCOVA was used to determine statistical significance between the variables recorded. Results were considered statistically significant when a P value was less than 0.05. All data are reported as mean and SD (SD). 
Results: From analysis of the individual's Fitbit Charge™, step count over a 2 week period as a measure of physical activity and total sleep time were recorded. The step count in the collegiate eSport players was 6040.2 ± 3028.6, and the step count in the age-matched controls was 12843.8 ± 5661.1. This showed a statistically significant difference, with P=.004. However, for the total sleep time, the eSport players had an average of 388 ± 98 minutes of sleep per night, as compared with an average of 441 ± 1.03 minutes of sleep per night in the age-matched controls. However, there was no significant difference in sleep time (P=.07). Through the GE Lunar DEXA machine, BMI, body fat percentage, total fat mass, regional fat mass (arm fat mass, leg fat mass, etc.), total lean mass and regional lean mass were determined and compared between the eSport players and the age-matched controls. There was a statistically significant difference in body fat percentage (P=.05), total lean mass (P=.003), and regional lean mass (P values all <.05). However, there was no statistically significant difference in BMI (P=.35). 
Conclusion: Our study supported both the primary and secondary hypotheses, which stated that eSports players would be significantly less active and that they would have higher body fat % and lower lean body mass. Additionally, the study helped support the notion that although BMI may be acceptable in many eSport athletes, perhaps looking at body composition (specifically body fat percentage and lean body mass) would be a more effective tool to use to determine health. Future research is needed to support the effectiveness of body composition parameters over BMI. Although this study was designed for collegiate eSport players, the results may be applied to patients who live a more sedentary lifestyle. Therefore, the importance of body composition may provide more merit in determining overall “health”, with less significance on using BMI as a measure. This can help physicians on providing proper counseling to improve a patient's well-being. In the initial phases of the study, questionnaires were sent out to all participants to determine their level of fitness. As such, the self-reporting questionnaire may be a limitation since we cannot prove the amount that the participants actually exercised. Another limitation is a result in the Fitbit Charge™, and although it is excellent at tracking steps, it cannot track other physical activities. This includes weightlifting or riding a bike. 
*C24—Osteopathic Philosophy
The Effectiveness of Anticipatory Guidance Presented Via Video During Wait Times in the Pediatric Office 
Monika Marie Sullivan, OMS IV1; Nidhi P. Sheth, OMS IV2; Luz E. Herrera, OMS III2; Thalia Fabian, OMS I2; Sandy Hanna, OMS II2; Mariam W. Fahim, DO2; Lisa M. Warren, DO2; Mary Ann Magoun, DO2; Alissa Craft, DO2 
1Western University of Health Sciences 
2Department of Pediatrics, Western University of Health Sciences COMP 
Statement of Significance: An essential aspect of osteopathic practice includes a patient-centered approach, which focuses on health promotion and disease prevention. Effective delivery of anticipatory guidance (AG) remains invaluable to implementing this philosophy in clinical practice. The effectiveness of and ability to provide comprehensive counseling continues to be restricted by limitations on visit times. Patients additionally experience significant nonproductive wait times in the pediatric clinic due to variations in clinic workflow, which correlate with decreased patient satisfaction. By providing AG during wait times, providers can ensure that every parent receives comprehensive, standardized information while utilizing time spent waiting for the provider. 
Methods: Anticipatory guidance (AG) is targeted to the parents of children 2-4 years old in the first 6 months within the age group. The AG content and goals were obtained from American Academy of Pediatrics (AAP) Bright Future Guidelines and Help Me Grow Minnesota. AG content was aimed to provide health guidance and expectations regarding patients leading up to the next growth milestone. This content is supplementary to standardized AAP handouts and the end of visit summary offered at each appointment. Once a patient and parent who meet the inclusion criteria are checked in, they are roomed to wait for the provider. The appropriate video is played, dependent on age group for the patient and the preferred language for the parent on the wall mounted television or tablet. The provider enters the examination room following an approximate 10 minute wait-time postrooming, as is standard in the involved clinics. The provider and physician continue the visit, and the provider addresses questions from the patient--both related or unrelated to the video. Parents are then asked to complete an anonymous 8-item survey to assess their satisfaction with the delivery of anticipatory guidance through the use of videos during their wait time. The questionnaire is written in a second to fifth grade level to ensure comprehension and is offered in both English and Spanish. One hundred twenty parents of children 2 to 4 years old presenting for a well child visit are to be included in the study. 
Data Analysis: Data analysis was performed on preliminary data from 49 administered in outpatient clinics, following videos being played during wait-time and discussions with the provider. Surveys used a Likert scale allowing parents of patients to rate the video on whether it was a good use of their wait time, it taught important information about their child's development, it helped them better understand expected milestones, and it better prepared them for their discussion with their provider. The Likert scale consisted of 6 rankings ‘strongly disagree (1)’, ‘disagree (2)’, ‘disagree somewhat (3)’, ‘agree somewhat (4)’, ‘agree (5)’, and ‘strongly agree (6)’. Patients also ranked whether they would like to receive video anticipatory guidance during future wait times on the same previously mentioned scale. Descriptive statistics were calculated by JASP software and are presented as means and SDs for continuous variables, and frequencies and proportions for categorical variables. 
Results: As data are currently being collected for this ongoing study, conclusive results are pending. Preliminary data from 49 surveys, collected from outpatient clinics, showed that majority of parents estimated their wait time to have been 5-10 minutes (64%), while the rest indicated it to be 15-20 minutes and 20-40 minutes (28% and 9%, respectively). These results make the duration of the anticipatory guidance videos (10 minutes) a potential fit for most outpatient clinics. Overall, the majority of parents (94%) felt that anticipatory guidance videos were a productive use of time while waiting to be seen by a provider. Furthermore, most parents (81%) indicated they better understood the developmental milestones to expect of their children by watching a video and felt better prepared for their discussion with the provider (86%). The majority of responders (88%) said they would like to continue receiving educational videos during their wait time at future appointments. Descriptive data analysis of parents’ responses showed that parents most commonly responded that the video was a productive use of their wait time (mode=5.0, µ=5.02, SD=0.96),it better prepared them for their discussion with the provider (mode=5.0, µ=4.75, SD=1.3), they learned important information about their child's development from the video (mode=6.0, µ=4.77, SD=1.42) and they would like to continue to watch anticipatory guidance videos in future videos (mode=5.0, µ=4.82, SD=1.30). 
Conclusion: This study aims to combine 2 critical complexities in pediatric primary care: that anticipatory guidance is the mainstay of well-child visits and that patient wait times are related to patient satisfaction. While studies have delved into ways to increase clinic workflow in order to decrease patient wait times, research has not yet specifically tested if anticipatory guidance given during this time increases patient satisfaction and knowledge acquired. By testing parents’ perceptions of knowledge gained and use of wait time for delivering anticipatory guidance, this study sheds light on whether this practice should be made standard across pediatric clinics. Some limitations of our study include sample size and specific inclusion criteria. Additionally, the videos used were only offered in English and Spanish, therefore our data do not reflect cultural views of other populations in regards to receiving anticipatory guidance. Surveys were not completed until after the patient visit with the pediatrician, possibly resulting in confounding of satisfaction with the overall visit experience. 
Future studies may aim to explore various age groups, interactive technology, and knowledge retention related to the delivery of anticipatory guidance. 
Acknowledgment/Funding Source: Western University of Health Sciences, Graduate College of Biomedical Sciences. 
References
1. AD Racine, AG Davidson. “Use of a Time-Flow Study to Improve Patient Waiting Times at an Inner-city Academic Pediatric Practice. Arch Pediatr Adolesc Med. 2002;156(12):1203-1209. doi:10.1001/archpedi.156.12.1203. 
2. Glascoe, F. P., F. Oberklaid, P. H. Dworkin, and F. Trimm. “Brief Approaches to Educating Patients and Parents in Primary Care.” Pediatrics 101.6 (1998): n. p. Web. 
3. Reisinger K, Bires J. Anticipatory Guidance in Pediatric Practice. Pediatrics. 1980; 66(6) :89-92. 
4. Schuster M, Duan N, Regalado M. Anticipatory Guidance. What Information Do Parents Receive? What Information Do They Want? Arch Pediatr Adolesc Med. 2000; 154(12):1191-8. 
5. Wheeler J, Fair M, Simpson P. Impact of a Waiting Room Videotape Message on Parent Attitudes Toward Pediatric Antibiotic Use. Pediatrics. 200: 108(3):591-6. 
★*C25—Impact of Osteopathic Manipulative Medicine (OMM) and Osteopathic Manipulative Treatment (OMT)
The Efficacy of Treating Thoracic Cage Counterstrain Tender Points With Varied Mobile Point Time Durations in a Classroom Setting 
Jessica Marie Smith, OMS II1; James Docherty, OMS III1; Patricia Kooyman, DO2; Sheldon Yao, DO2 
1New York Institute of Technology College of Osteopathic Medicine 
2Department of Osteopathic Manipulative Medicine, New York Institute of Technology College of Osteopathic Medicine 
Statement of Significance: Using Osteopathic Manipulative Treatment (OMT) in the clinical setting is often limited by time constraints of each patient visit. If CS for 90 seconds is as effective as CS for 120 seconds, this information is important for physicians to be aware of to increase efficiency at each visit. Furthermore, physicians that may have previously been reluctant to utilize CS of rib and thoracic regions given time constraints may feel more compelled to use this treatment option knowing the shorter duration is effective. 
Research Methods: Participants were second year medical students from the New York Institute of Technology College of Osteopathic Medicine (NYITCOM) who treated their fellow student partner, whom they had diagnosed with an anterior or posterior thoracic or rib tender point. Different laboratory sessions were randomized to hold the mobile point for either 90 or 120 seconds. The entire class was asked to complete an online form that documented the point, the duration of holding the point, and the pre- and post pain level (on a scale of 0-10) of the tender point if there was a true tender point present. In total, there were 392 entries for treatment of a rib tender point (209 treated for 90 seconds and 183 treated for 120 seconds) and 170 entries for treatment of a thoracic tender point (134 treated for 90 seconds and 36 treated for 120 seconds). 
Data Analysis: Data was gathered via an online questionnaire and analyzed with Excel. Data was collected from 688 students throughout laboratory days during the period of 8/22/2018 - 9/20/2018. Data from 562 students was used for this study and CS treatments that used different durations of time outside the 90 or 120 second intervals were excluded. Paired Sample t tests were used to compare pain before and after CS was used. A simple linear regression model was used to find a possible correlation between pain relief and time. 
Results: CS was found to be effective at relieving pain when treatment was held for 90 or 120 seconds at either ribs or thoracic tender points (P<.0001). No correlations were found between pain relief for rib CS and time held (P=.295). Furthermore, the same was true when comparing time held of the thoracic tender point location (P=.886). 
Conclusion: CS was highly effective in reducing pain of both thoracic and rib tender points when treated for 90 or 120 seconds. The difference in duration of treatment, time held, for each tender point was not statistically significant. Limitations of this study include that this was a classroom setting and the rib and thoracic tender points were diagnosed on non-symptomatic students. These findings suggest that CS for rib, as well as thoracic, tender points can be held for 90 seconds instead of 120 seconds. Further research is needed to correlate these findings in the clinical setting. 
*C26—Impact of Osteopathic Manipulative Medicine (OMM) and Osteopathic Manipulative Treatment (OMT)
Osteopathic Manipulative Medicine Vs Counseling in the Treatment of Sports-Related Concussion: Comparative Balance Assessment 
Justin Zelig Morris, OMS IV1; Jaanki Shah, OMS II2; Hallie Zwibel, DO, MPH1; Jayme Mancini, DO PhD2; Sheldon C. Yao, DO FAAO2 
1New York Institute of Technology College of Osteopathic Medicine 
2Department of Osteopathic Manipulative Medicine, New York Institute of Technology College of Osteopathic Medicine 
3Department of Family Medicine, New York Institute of Technology College of Osteopathic Medicine 
Statement of Significance: This study constitutes and important investigation into the treatment of concussion symptoms, specifically the efficacy of OMM in treating concussion. 
Research Methods: Data were derived from a randomized-controlled study on the effects of OMM on concussion conducted at the Academic Healthcare Center (AHCC) in Old Westbury, NY. Participants were included based on having received an ICD9/10 diagnosis of concussion due to collegiate athletic event and verified medical clearance of any life-threatening medical condition. This study assessed balance SOT at 3 time points, yielding a composite score at each visit. Participants received OMM treatment or physician counseling on concussion during visit 1, the day of evaluation and consent to participate in the study, and during visit 2, 48-72 hours post visit 1. SOT was administered during Visit 1,2, and Visit 3, which was 1 week after Visit 1. OMM treatment was delivered by an NMM/OMM specialist who addressed any somatic dysfunctions of the cranium, spine, or extremities to decrease musculoskeletal restrictions that would contribute to concussion symptoms. The study was approved by the New York Institute of Technology Institutional Review Board (BHS-1139). 
Data Analysis: We scored the first 7 symptoms in the SCAT-5 to create a subscore with possible scores ranging from 0 to 42. The SCAT subscore is a derivation of the SCAT that takes into account only the first Data were analyzed using SPSS Version 25. Repeated Measures ANOVA was used for both SOT and SCAT subscoring. 
Results: Twenty-nine participants were included. Fourteen received counseling alone while fifteen received OMM. Composite scores of SOT, as well as a SCAT sub-score (select symptoms) were compared within- and between groups using a Repeated Measures Analysis of Variance. Within-groups analysis (comparison of scores between visits) of SOT and SCAT sub-scores were statistically significant (both P<.0001). Interaction terms (time*group, i.e. a combined comparison between time and treatment group) for both tests were not statistically significant (P=.994 for SOT and P=.498 for SCAT sub-score, respectively). 
Conclusion: These data show time-dependent improvement in post-concussion balance symptoms via SOT and SCAT sub-score regardless of intervention or lack thereof. Although participants treated with OMM may report benefit, alternate testing protocols or severities of included participants’ injuries are needed in order to display such effects. Duplication of this study design amongst patients with more severe traumatic brain injury and/or a greater overall n-value may expose greater benefit of OMM. 
*C27—Musculoskeletal Injuries and Prevention
Assessing Physiological Changes Using Wearable Technology in Collegiate eSports Players While Gaming 
Tamzid Hassan, OMS II1; Sophia Ahmed, OMS II2; Kyle Yuen, OMS II2; Arline Allera, 2; Amber Sousa, PhD2; Joanne DiFrancesco-Donoghue, PhD, Principle Investigator1 
1New York Institute of Technology College of Osteopathic Medicine 
Statement of Significance: Many colleges now have a collegiate eSports team in addition to conventional sports. eSport players, like traditional athletes, often practice for long hours and thus are vulnerable to negative health effects. However, there is a lack of research on the health of these players, such as potential physiological changes during gameplay. These changes can be an indicator of the players’ health, and can help coaches and doctors determine when an intervention is necessary. For example, if players experience eye strain after 2 hours of practice, then they may need to take a break. In addition, osteopathic medicine recognizes the importance of monitoring these conditions to ensure that they do not affect the players’ performance when practicing. 
Methods: This pilot, observational cohort study (n=8) was conducted at the New York Institute of Technology (NYIT) College of Osteopathic Medicine in the NYIT eSports Arena. It was approved by the NYIT Internal Review Board and all participants signed consent forms to participate. Inclusion criteria included NYIT students that played video games competitively. Exclusion criteria included students that did not play video games competitively. 4 participants were observed for 1 hour of gameplay, and another 4 participants were observed for 2 hours of gameplay on separate days. All participants were fitted to wear a Hexoskin® wearable technology shirt prior to play according to the manufacturer's guidelines. The following study outcomes were observed: 
1. Heart Rate: before and after practice, heart rate was measured manually. During practice, participants wore a Hexoskin® fitted shirt that calculated the heart rate variability and the peak heart rate. 
2. Blood Pressure: a Welsh-Allen® sphygmomanometer was used to measure blood pressure prior to and after gameplay. 
3. Respiratory Rate: before and after practice, respiratory rate was measured manually. During practice, participants wore a Hexoskin® suit that measured respiratory rate variability. 
4. Digital Eye Strain: participants looked at a pocket Snellen eye chart, which was held 14 inches away, before and after gameplay. To analyze eye strain, the visual acuity score was converted into a decimal (eg. 20/25 vision=0.8). 
Data Analysis: For the primary hypothesis, a 2-way paired t test (P<.05) was used. For the secondary hypothesis, a 2-way, independent t test with equal variance (P<.05) was used. Primary hypothesis: for players who practiced for 1 hour, there was no significant difference before and after practice in heart rate (P=.916, 73.75 bpm +/- 6.798), respiratory rate (P=.383, 15 breaths per minute +/- 1.265), systolic blood pressure (P=.735, 119.25 mm Hg +/- 7.479), diastolic blood pressure (P=.878, 73.25 mm Hg +/- 4.132), and visual acuity (P=.220, 0.803 +/- .189). For players practicing for 2 hours, there was also no significant difference pre- and postpractice in heart rate (P=.581, 81.625 bpm +/- 6.368), respiratory rate (P=.500, 13.5 breaths per minute +/- 1), systolic blood pressure (P=.069, 123.5 mm Hg +/- 8.812), diastolic blood pressure (P=.089, 83.125 mm Hg +/- 7.019), and visual acuity (P= 1.00, 0.950 +/- 0.093). Secondary hypothesis: during gameplay, there was no significant difference between the one-hour group and 2-hour group in heart rate variability (P=.300, 70.265 bpm +/- 30.863) and peak heart rate (P=.246, 130.375 bpm +/- 27.333). However, there was a significant difference in respiratory rate variability (P=.033, 47.375 +/- 18.431 breaths per minute). 
Results: Primary hypothesis: there was no significant difference in heart rate, respiratory rate, blood pressure, and visual acuity before and after gameplay for both players in the one-hour practice group and the two-hour practice group. However, using descriptive statistics, players who practiced for 2 hours displayed a higher heart rate, blood pressure, and visual acuity score than those who practiced for 1 hour. The average postpractice respiratory rate was lower in the 2 hour practice group. Secondary hypothesis: during practice, the respiratory rate variability was significantly lower in players who played for 2 hours than players who played for 1 hour, suggesting those that practiced longer became more fatigued. While there was no significant difference between the 2 groups in terms of heart rate variability and peak heart rate, using descriptive statistics, players practicing for 2 hours had a higher heart rate variability and higher peak heart rate. 
Conclusion: Although eSports players remain sedentary when playing video games, they do experience changes in their physiology. These changes represent physiological changes from stress, and are not the same physiological changes that are seen with exercise. The results of this pilot study suggest that even after 2 hours of practice, there were no changes in the players’ vital signs except for respiratory rate variability. One of the reasons for the large range in respiration is that some players talked frequently to teammates when practicing (especially for multiplayer games), whereas others talked less or not at all. eSports players often practice far longer than 2 hours, which could result in changes to their physiology and is something that a future experiment can investigate. In addition, players in this study played games in a casual practice setting and were not actively in a competition, which may reduce stress. If they were to play video games in a tournament, though, then they may experience significant amounts of stress and pressure. This environment could also cause changes in their physiology, and is another area that needs to be further investigated. 
*C28—Osteopathic Philosophy
Changing the Presentation of the Seasonal Influenza Vaccine: An Effort to Improve Vaccination Rates of Children in a Federally Qualified Health Center 
Jennifer Otterbacher, DO1; Serine C. Banczak, DO2; Micah R. Davis, DO2 
1Grandview Medical Center 
2Family Medicine Residency, Grandview Medical Center 
Statement of Significance: During the 2017-2018 influenza season, there were 180 pediatric deaths reported to the Center for Disease Control (CDC). The seasonal influenza vaccine is an effective method to prevent death caused by influenza. Center for Medicaid and Medicare Services (CMS) monitors performance of health care centers that vaccinate children receiving Medicaid or Medicare services and requires 2 seasonal influenza vaccines be given to children aged 6 through 35 months to be considered fully vaccinated, in addition to the CDC vaccine schedule. Multiple other studies are being conducted to increase rates of vaccination using reminders and parent education. However, these protocols also require additional visits, which create additional barriers. 
Research Methods: Patients were identified using I2I software integrated with NextGen electronic medical record. The control group was identified as pediatric patients ages 6 months through 35 months, with office visits occurring during a set time frame. The designated time frame for data collection, referred to as influenza vaccination season, was defined as October 1st through March 31st, 2017-2018 and 2018-2019, with the former time frame being deemed the control group, and the latter as the test group. At the start of the 2018-2019 season, physicians and office staff were educated on presenting the seasonal influenza vaccine as a regularly scheduled vaccine. Staff and physicians were reminded periodically throughout the season to ensure continued compliance with the requested vaccination presentation strategy. 
Data Analysis: Total number of pediatric patients seen in the desired time frames were recorded, as were the number vaccinated with the seasonal influenza vaccine. Total number of patients seen for the control group was 130 and total number of pediatric patients seen for the study group was 125. Group sizes were similar allowing for a more accurate comparison. Data are sufficient to assess the research question for the study population. A χ2 analysis was performed on the data using a P<.05 as significant to further compare data for importance of the changes made during the study period. 
Results: In the control group, a total of 130 visits were recorded for the desired age group and seasonal influenza vaccines were received by 71 (55%) patients during these visits. In the study group, a total of 125 visits were recorded for the desired age group. Seasonal influenza vaccines were received by 89 (71%) patients during these visits. A χ2 analysis comparing patients in each group that did not receive the seasonal influenza vaccination to those who did. Analysis revealed a χ2 statistic of 7.4983 with P=.0062, with P=.05 as significant. 
Conclusion: This study revealed a statistically significant increase in pediatric patients who received the seasonal influenza vaccine during the 2018-2019 influenza season. This increase was achieved by presenting the seasonal influenza vaccine as a part of the regularly scheduled CDC vaccine schedule. These results allow physicians and staff to continue to provide quality preventative care in a Federally Qualified Health Center and family medicine residency setting. However, these results will have to be reproduced on a larger scale for them to be more applicable to other patient populations. Limitations of this study include small group numbers for analysis. 
References
1. Childhood Immunization Status per CMS. Retrieved from https://ecqi.healthit.gov/ecqm/measures/cms117v4 
2. Freedman, J. L., Reilly, A. F., Powell, S. C., & Bailey, L. C. (2015). Quality Improvement Initiative to Increase Influenza Vaccination in Pediatric Cancer Patients. Pediatrics,135(2). doi:10.1542/peds.2014-0943 
3. Childhood Immunization Status. (n.d.). Retrieved from https://ecqi.healthit.gov/ecqm/measures/cms117v4 
4. Quality of Care from Health Resources and Services Administration https://bphc.hrsa.gov/qualityimprovement/performancemeasures/qualitycare.html 
*C29—Impact of Osteopathic Manipulative Medicine (OMM) and Osteopathic Manipulative Treatment (OMT)
Facial Effleurage Treatment Increases Serum TNFα Levels in Patients with Acute Rhinosinusitis 
Abigail White, OMS II; Chelsea J. Weidman, MS; Jillian H. Bradley, PhD 
Department of Microbiology and Immunology, The Edward Via College of Osteopathic Medicine - Carolinas Campus 
Statement of Significance: Acute rhinosinusitis is a common condition affecting millions of adults annually in the United States, accounting for 21% of all outpatient antibiotic prescriptions. Estimates have been made that rhinosinusitis causes an annual health care expenditure of several billion dollars. The osteopathic manipulative treatment of facial effleurage is a potential alternative treatment that can be used on patients with suspected viral infections, or in conjugation with antibiotics in bacterial infections. Facial effleurage performed on acute rhinosinusitis patients may help relieve symptoms and expedite recovery time. 
Research Methods: In a parallel-arm, randomized, placebo-controlled clinical trial, patients that presented to 2 outpatient, direct primary care clinics in a mid-sized manufacturing town are asked to participate. Informed consent and enrollment eligibility is confirmed. Participants are then randomly assigned to 1 of the 8 treatment groups: healthy control (HC), HC with physical touch (PT), HC with Facial Effleurage (FE), rhinosinusitis (RS) with antibiotics (Abs), RS with PT, RS with FE, RS with Abs and PT, and RS with Abs and FE. Physical touch is the sham/placebo treatment. Peripheral blood samples are then collected. The treatment is performed and 1 hour after the initiation of facial effleurage serum samples are collected again. Peripheral blood is also collected at a follow-up appointment 7 days after treatment. Serum TNFα levels are then measured via ELISA. 
Data Analysis: Descriptive statistics were used to determine the mean and SD between groups. ANOVA analyses were used to determine if there are statistical differences in serum TNFα levels between treatment groups. A p-value of 0.05 was used to determine statistical significance. All analyses were performed using GraphPad Prism Software. 
Results: The difference between sick patients and healthy controls prior to treatment was not statistically significant, but sick patients tend to have higher levels. Patients who received facial effleurage had significantly increased TNFα levels 1 hour after treatment compared with healthy patients, patients that received only antibiotics, and patients that received the sham treatment. On follow-up 7 days after facial effleurage, TNFα is increased in sick patients, although not significantly. 
Conclusion: TNFα is significantly upregulated in the blood after facial effleurage 1 hour after treatment, and this increase might persist over at least a week after 1 treatment session. This might partly explain the beneficial effects of facial effleurage on patients as TNFα exodus could potentially decrease the swelling and pain the patients experience, as well as ushering in the healing response rather than prolonging the state of inflammation. This would be particularly valuable when the proinflammatory response is no longer warranted. If occurring, patients may clear the infection at a faster rate than those without treatment or those only receiving antibiotics. Through this research there is potential for an improved standard of care for acute rhinosinusitis involving facial effleurage and to decrease the reliance on antibiotics. At this time, more research is necessary to fully understand the complex relationship between FE, serum TNFα, and acute rhinosinusitis infections. 
Acknowledgement/Funding Source: Thank you to Palmetto Proactive Healthcare, Dr. Chris McCarthy, Dr. Jerome Aya-Ay, and Dr. Oshea Escamilla for patient recruitment. Thank you to Drs. Matthew Cannon DO, Oshea Escamilla DO, and Jordan Lakin DO for performing OMT. 
Thank you to: Alexis Stoner, MPH, PhD; Randal Gregg, PhD; Ning Cheng, PhD. 
Funded by The American Osteopathic Association (Grant Number - 2031815722). 
Pilot data provided by Research Eureka Accelerator Program at Edward Via College of Osteopathic Medicine. 
References
1. Schumann, S., and J. Hickner. 2008. Patients Insist on Antibiotics for Sinusitis? Here Is a Good Reason to Say ‘No. The Journal of Family Practice 57 (7): 464-468. 
★*C30—Impact of Osteopathic Manipulative Medicine (OMM) & Osteopathic Manipulative Treatment (OMT)
Constipation in Parkinson's Disease Improved by an Osteopathic Manipulative Medicine Sequence in a Repeated Measures Study 
Saumya Valasareddi, OMS II1; Melvin Mathai, OMS III1; To Shan Li, DO2; Sheldon Yao, DO2; Jayme Mancini, PhD, DO1 
1New York Institute of Technology College of Osteopathic Medicine 
2Department of Osteopathic Manipulative Medicine, New York Institute of Technology College of Osteopathic Medicine 
Statement of Significance: The impact of this study is that it is assessing the effect of OMM in PD in which constipation symptoms often impair quality of life as much as motor symptoms and may become severe enough to require hospitalization. 
Methods: The pathophysiological factors contributing to constipation and gastrointestinal dysmotility in PD were determined from literature review and clinical expertise with applying the 5 osteopathic treatment models. This treatment sequence combined techniques to specifically address PD-related factors. The goals of the techniques were normalization of the ANS dysregulation, balance tone of the pelvic floor muscles that may be dystonic, improve gastrointestinal inertia to reduce the bradykinesia effects on the gastrointestinal system, and release myofascial restrictions to allow for better thoracic excursion and diaphragm motion to enhance their pumping mechanics. An NYIT-IRB-approved (BHS1065), Clinicaltrials.gov# NCT02344485 repeated measures study on men and women over 40 years old with constipation and PD was conducted. Exclusion criteria included no PD, no constipation, other neurodegenerative disease, acute illness, and relative and absolute contraindications to OMM. PD severity was quantified by a standardized, validated assessment. Constipation severity, symptoms, and quality of life were measured by validated questionnaires for 4 weeks of no-intervention, 4 weekly OMM-sequence treatments, and 2 weeks of no-intervention. Gastrointestinal motility was measured using the Bristol 7-type stool scale by participants and participant-obtained stool photos by investigators. The participants’ past and weekly medical history, including medications, exercise, and nutrition were documented. 
Data Analysis: A previously calculated mean score improvement with pharmaceutical management of constipation on PAC QOL of 11pts and overall effect size of 1.77 was used to determine sample size. The initial measures of UPDRS, age, years of PD, years of constipation, weight, and sex were compared with the initial constipation measures. The repeated outcome measures Wexner Cleveland Clinic Constipation Severity scoring system, PAC-SYM, and PAC-QOL of mean pre-OMM were compared with postOMM using repeated measures ANOVA with P<.05 considered significant. The inter-rater reliability between weekly participant and investigator Bristol stool scale ratings was calculated with participant and investigator ratings within 20% of each other being considered agreement. Variables from the weekly medical and health history were quantified and evaluated for variability and effect on repeated measures. 
Results: The OMM-sequence addressed ANS dysfunction, enteric nervous system (ENS) dysfunction, puborectalis muscle dystonia, bradykinesia, and restricted respiratory syndrome that contribute to constipation in PD. Age, MDS-UPDRS total score, and H&Y (n=7) did not significantly correlate with constipation severity, symptoms, or quality of life. Treatment was well tolerated and participants easily monitored their constipation by using the Bristol stool scale. There were significant improvements in the Wexner Cleveland constipation severity 4.2 pts (P<.001) and PAC-QOL 10.6 pts (P=.002). The mean Bristol stool 7-type Scale rating improved from type-2 to type-3. The goal of type 3 or 4 on the Bristol Stool scale was reached by 5 (71%) participants with no significant change in pharmaceutical or behavioral management. Participants had a 7% improvement in quality of life receiving this OMM-sequence in adjunct to their existing management. 
Conclusion: This OMM-sequence for constipation in PD significantly improved severity and quality of life when applied once weekly. There was good inter-rater reliability of the participants upon teaching them how to use the Bristol stool scale for self-monitoring. By addressing the features of ANS and ENS dysregulation, pelvic floor muscle dystonia, bradykinesia, and restricted respiratory syndrome contributing to constipation in PD, this OMM-sequence procedure significantly improved constipation severity scores and participant assessment of constipation quality of life scores. Limitations of this study include inability to isolate the effects of participant medications on the gastrointestinal tract, lack of an independent control group, and relying on participant tracking of diet, fluid intake, and physical activity. The Rome criteria was designed for functional constipation in the absence of secondary factors, such as medications and systemic illness, and thus its applicability in the PD population is not clear. Application of the Rome criteria also requires that participants be asked about their bowel habits when not taking medications for constipation. This approach was not applied in this study because the common use of medications among our participants to address their constipation would have made it impractical for finding eligible participants. Future research can try to capture more detailed information on factors such as food intake, hydration, and activity to better assess influences on constipation. 
Acknowledgment/Funding Source: Funding was made possible by an internal NYIT institutional grant of $10,000. 
References
1. Agachan, F. Chen, T. Pfeifer, J. Reissman, P. Wexner, SD. A constipation scoring system to simplify evaluation and management of constipated patients. Diseases of the Colon and Rectum. 1996; 39(6); 681-685. 
2. Asahina M, Vichayanrat E, Low D, Iodice V, Mathias C. Autonomic dysfunction in parkinsonian disorders: assessment and pathophysiology. J Neurology, Neurosurg & amp; Psychiatry. 2013;84(6):674-680. doi:10.1136/jnnp-2012-303135 
3. Belvaux A, et al. Osteopathic management of chronic constipation in women patients. Results of a pilot study. Clin Res Hepatol Gastroenterol. 2017; doi:10.1016/j.clinre.2016.12.003 
4. Verbaan D, Marinus J, Visser M, van Rooden SM, van Hilten JJ. Patient-reported autonomic symptoms in Parkinsons Disease. Neurology. 2007;69(4):333-341. 
5. Watari J, Danowitz M, Jacob S, Li TS. Etiology, evaluation, and osteopathic management of adult constipation. Osteopath fam physician. 2016;8(4):24-31 
*C31—Musculoskeletal Injuries and Prevention
Retrospective Medical Record Review of Post-Concussion Balance Assessment by Symptom Scoring and Sensory Organization Testing 
Nathan Paluso, OMS II1; Justin Morris, OMS IV2; Amanda Defeo, OMS II2; Jaanki Shah, OMS II2; Matthew Betschart, OMS II2; Hallie Zwibel, DO, MPH, FAAFP3; Sheldon Yao, DO, FAAO1 
1New York Institute of Technology College of Osteopathic Medicine 
2Department of Osteopathic Maniuplative Medicine, New York Institute of Technology College of Osteopathic Medicine 
3Department of Family Medicine, New York Institute of Technology College of Osteopathic Medicine 
Statement of Significance: This study examines balance impairment among young adults who were diagnosed with concussion at an academic health care center. Given that Osteopathic Manipulative Medicine (OMM) serves as a potential treatment option for concussion and is offered at this facility, it is important to understand the patterns of balance-related symptoms and measurable deficits in patients with concussion. 
Methods: Data were derived from a database of patients who received Sensory Organization Testing (SOT) at the Academic Health care Center (AHCC) in Old Westbury, NY between 9/1/15 and 6/18/19. Participants were included based on having received an ICD9/10 diagnosis of concussion as verified in electronic medical records (EMR). Patients who were administered SOT for other clinical indications were excluded. Corresponding SCAT total symptom scores, as well as those scores from SOT and SCAT at follow-up visits, if applicable, were recorded. The study was approved by the New York Institute of Technology Institutional Review Board (BHS-1167). 
Data Analysis: Data were completed using Microsoft Excel and RStudio. Patients were separated into those who were seen for 1 visit or more than 1 visit at the AHCC for concussive events. New concussive events were given individual first- or second-visit designation, etc. Among patients who were seen for more than 1 visit, SOT and SCAT scores were compared via 1-way analysis of variance (ANOVA). 
Results: A single-visit patient population was defined as having 1 visit where both SOT and SCAT scores were recorded (n=38) and a multiple-visit patient population was defined as having more than 1 visit where both SOT and SCAT were recorded (n=15). Average SOT composite and SCAT scores for single visit patients were 73.33 (SD=18.33) and 18.44 (SD=12.85), respectively. Among multiple-visit patients, SOT scores increased between their first, second, and third visits (mean=77.6 [10.5], 84.42 [7.01], and 88.4 [1.14], respectively; P<.01). SCAT scores for this patient population decreased between their first, second, and third visits (mean [SD]=36.8 [26.05], 20.42 [27.46], and 14.8 [27.65], respectively; P<.05). Analysis of SOT vs SCAT showed an inverse relationship between these variables for single-visit patients, as well as among multiple-visit patients’ first visits (y=-0.33x + 79.416, R^2=0.2217 and y=-0.0987x + 81.233, R^2=0.06, respectively). However, a direct relationship was shown between SOT and SCAT for multiple-visit patients’ second and third visits (y=0.0368x + 83.669, R^2=0.0208 and y=0.0158x + 88.166, R^2=0.1473, respectively). 
Conclusion: These findings help illustrate the patterns of SOT and SCAT scores measured in single and multiple visits to an academic health care center following concussion. These data could be enhanced through more consistent use of both SOT and SCAT at every visit following concussion. As expected, scores reflected more minor impairment (higher SOT and lower SCAT) at single visits and improvement in each parameter in serial visits. The trends of SOT and SCAT scores become more discrepant with time in serial visits postconcussion, raising the possibility that they differ in their reliability as diagnostic tools to help clinicians manage concussion. These results suggest that SOT scores do not entirely reflect the trends seen in participantive symptom scoring following concussion. 
*C32—Chronic Diseases and Conditions
The Effects of Routine Exercise on Acute Rhinosinusitis 
Hayden Christopher White, OMS II1; Chelsea J. Weidman, MS2; Jillian H. Bradley, PhD2 
1The Edward Via College of Osteopathic Medicine - Carolinas Campus 
2Department of Microbiology and Immunology, The Edward Via College of Osteopathic Medicine - Carolinas Campus 
Statement of Significance: Acute rhinosinusitis is a condition that has been treated with antibiotics even though antibiotics have a minimal effect on symptom resolution. The over-prescription of antibiotics is contributing to the development of antibiotic-resistant organisms. If routine physical activity can reduce the symptom severity of acute rhinosinusitis, then encouraging the population to maintain a healthy level of physical activity may result in fewer afflicted patients presenting for treatment. This decrease in presenting patients could help alleviate the problem of antibiotic over-prescription and help reduce the strain on the health care system. Furthermore, this benefit to physical activity could help in the fight against the growing obesity problem. 
Research Methods: This study utilized data from a parallel-arm, randomized, placebo-controlled clinical trial evaluating the efficacy of Facial Effleurage. Patients presenting to 2 outpatient, direct primary care clinics in a mid-sized manufacturing town are asked to participate. After an informed consent is given, the patient is screened for enrollment and determined to be either sick or healthy. Samples of the nasal mucus secretions and serum are collected. Patients answer surveys asking the patient how bad their current symptoms are. Then, patients are asked about their level of physical activity and are placed into 1 of 4 categories. The categories reflect the patients self-reported level of physical activity as minimal, mild, moderate, or intense physical activity. Then the patients record the severity of their symptoms every 12 hours for the next 7 days. The patients report to the clinic for a follow-up appointment. The samples are taken, and the patient is asked about the resolution of symptoms. 
Data Analysis: Symptom Severity was determined by using the Sinonasal Outcome Test (SNOT-20), which is a validated questionnaire that ranks 20 different parameters from 0-5 depending on the severity of the symptom. The sum of these 20 parameters provides the Total Symptom Score and ranges between 0-100. Serum cytokine and antibody levels are measured by ELISA. Mucosal cytokine levels are measured by cytometric bead array. A power analysis revealed that a sample size of 40 is needed for the minimal effect needed. A p-value of less than 0.05 was considered significant. 
Results: So far, 86/200 patients have been enrolled in our study. The difference in IL-6 levels between our healthy controls and sick patients in our highest level of physical activity is statistically different. The reported total symptom score at patient presentation was statistically different between healthy controls and sick patients in all but our mild level of physical activity group. Finally, we saw the greatest reduction of symptoms after 1 week in our moderate level of physical activity group. 
Conclusion: Ultimately, more data is needed before drawing definitive conclusions. However, we are seeing data that corresponds with the literature indicating a decrease in chronic inflammation and general feelings of malaise in healthy individuals who have higher levels of routine physical activity. There appears to be some kind of benefit at every level of reported physical activity. This is very encouraging, and we hope to see a clearer picture once we have more patients enrolled. We recognize that the biggest limitation is the fact that patient's self-report their level of physical activity. This can easily lead to patients exaggerating their activity levels as well as confusion regarding different definitions of physical activity. However, we hope that by having fairly broad categories for physical activity we can minimize these reporting errors 
Acknowledgement/Funding Source: This work was funded by the American Osteopathic Association (Grant number 2031815722). Pilot data collected for this project was funded by The Edward Via College of Osteopathic Medicine (VCOM). We would like to thank the staff at Palmetto Proactive Healthcare for helping with blood collection and the Research Administration at VCOM for helping us with IRB approval and grant submission to fund this work. 
*C33—Chronic Diseases and Conditions
Intermittent Fasting 
Jonathan Junqua, OMS II; Elijah Lustig, OMS 1; Kim Pfotenhauer, DO; Jay Shubrook, DO 
Touro University College of Osteopathic Medicine (California) 
Statement of Significance: In osteopathic medicine, there is a focus on the well-being of the entire individual. Through intermittent fasting and testing how effective and safe it is to undergo fasting for 16 hours per day for 2 weeks, we aim to increase the self-efficacy that patients feel in controlling their diabetes while helping them ameliorate their diabetes. By doing so, we can address both the mental and and physical aspects of diabetes and see the patient as a whole. 
Research Methods: Participants were recruited from a pool including patients, staff, or coworkers of the study team, and who meet the inclusion criteria of having an A1c between 6.5-9.0%, diagnosed with Type 2 diabetes for at least a year, English speaking and over 18 years of age. Participants were equipped with continuous glucose monitors (CGM) and randomized by coin toss between a fasting and non-fasting study arms. The fasting arm consisted of fasting for 16 hours and unrestricted eating for 8 hours during 10 out of 14 days, while the non-fasting arm consisted of a normal diet for 14 days. Upon completion of the 2 weeks patients the opposite study arm with a new CGM. Although their diet was unrestricted, patients were provided a goal number of calories to consume in order to maintain their weight. Participants logged ketone levels and food items consumed during both study arms and their weights and BMI were measured before and after each study arm. Participants served as their own controls by undergoing both arms of the study. 
Data Analysis: Changes in weight, BMI, average ketone levels and average calorie intake per day were calculated for each participant for both study arms. Specifically for caloric intake, the difference was taken between the goal number of calories provided to participants to maintain weight and actual calories consumed. Significance of the differences between the 2 study arms in terms of weight, BMI, and average ketone levels were calculated using the 1 tailed matched pair t test. The difference of actual calorie intake from goal number of calories between study arms was tested for significance using a 2 tailed matched pair t test. 
Results: Participants did not have significant differences in terms of changes in weight or BMI between the fasting arm and the non-fasting arm (P=.1088 and P=.1126 respectively). However, when the weight before and after the fasting arm was compared, there was a statistically significant weight loss of 3 pounds (SD=2.8, P=.0376). This is in contrast to the non-fasting arm, which did not have statistically significant differences in weight before and after (P=.443). The differences in mean ketone levels between study arms was found to be statistically significantly greater in the fasting arm by 0.03 mmol/L (SD=0.027, P=.045). Finally, there was no statistically significant difference found between average difference in calorie consumed (P=.458). 
Conclusion: The finding that there was a significant weight loss in participants before and after the fasting arm points to the potential of intermittent fasting for addressing visceral obesity in Type 2 diabetics. In addition, there was a higher level of ketones found in during the fasting arm vs the non-fasting arm. However, the difference in ketone levels proved to be very small between the fasting and non-fasting arms, which can conversely be interpreted as the schedule of 16 hour fasting periods being safe from the danger of inciting diabetic ketoacidosis. The non-significance of the comparison of the difference of consumed calories vs goal calories could point to the variability of eating habits of the study participants. Some limitations for this study is the small sample size, as well as the potential to have incomplete or inaccurate data due to the self-reported nature of calorie counts. In addition, all the participants in our study were female. Future research opportunities should pursue the potential of this intermittent fasting schedule in men and with a larger sample of individuals with type 2 diabetes. 
Acknowledgement/Funding Source: Funding from Touro University COM. 
Acknowledgements: Jamie Katuna, Shounak Ghosh, Salima Mostafa, Solano County Family Health Services Staff. 
References
1. Sutton, EF, et al. Early Time-Restricted Feeding Improves Insulin Sensitivity, Blood Pressure, and Oxidative Stress Even without Weight Loss in Men with Prediabetes. Cell Metabolism Vol 27:6: 1212-1221. 5 June 2018. 
Health Services
*H1—Chronic Diseases and Conditions
Role of a Student-Run Free Clinic in an Urban Underserved Area 
Isabella Slaby, OMS IV; Radhika Rani, OMS-III; Roma Padalkar, OMS III; Sobiah Khan, OMS II; Shelly Sharma, OMS II; Adarsh K. Gupta, DO 
Rowan University School of Osteopathic Medicine 
Statement of Significance: The Camden Community Health Center not only provides health care, but connects patients to resources they may not previously have had access to, such as the free osteopathic manipulative medicine clinic at Rowan University School of Osteopathic Medicine. Furthermore, treatment plans are made with keeping the whole person and their circumstances in mind. Seeing as the clinic cares for vulnerable populations that may not be able to afford expensive treatments or drug therapies, clinicians take unique routes of care by providing patients with feasible lifestyle modifications, utilizing osteopathic manipulation, and taking the time to educate patients on the importance of maintaining a healthy body, so it may work as a unit. 
Research Methods: This is a retrospective chart review analyzing patients who sought care at the Camden Community Health Center office. Study institutional review board approval was obtained from the Rowan University School of Osteopathic Medicine Institutional Review Board prior to beginning the study. Permission to use the paper patient medical records was obtained from the Camden Clinic. Medical records were then selected randomly from the clinic medical record archive. Study staff made a combined effort to abstract information from paper medical records into a database using Qualtrics. 
Data Analysis: Data was analyzed using Excel and SQLite through DB Browser for SQLite. Demographic information such as age, race, gender, town of residence, and pre-existing conditions was collected. Additionally, details of the care received were collected, such as chief complaint, diagnosis, management and referrals, and transcribed into a digital collection form. Demographic information was tallied and the percentages of male and female, and town of residence was calculated as well as the mean patient age. The prevalence of pre-existing conditions was also determined and the most common new diagnoses and referrals were calculated using frequency functions. 
Results: A total of 201 medical records were abstracted and analyzed. The patient population ranged from infants to the elderly, with a mean age of 24.46±17.71 years (median age: 22.42 years). 82 patients were under 18, 77 between 18-40, and 42 greater than 40 years of age. 82% of patients visited the clinic once (165/201), while 17% (35/201) made subsequent visits. The majority of patients were from Camden (62%), with the rest being from the surrounding towns. The most common pre-existing conditions were asthma (N=30), hypertension (N=19), cardiovascular complications (N=11), chronic pain (N=11), and diabetes (N=9). The main services provided were physicals for work (25%) and school (22%) and associated laboratory work such as PPD skin testing. 30% (61/201) of patients came in for other complaints. 32% of patients had a new diagnosis after their visit, most commonly dermatologic (N=21), cardiac (N=17), respiratory (N=7), and psychiatric conditions (N=6). 26% of patients were prescribed new medications. 
Conclusion: The Camden Community Health Center provides a variety of health care services to patients living in and around Camden. The clinic most notably has a role in providing school and work physicals for the community and managing chronic diseases. Because the clinic has a policy of not accepting health insurance or charging fees, it also serves as an entryway to health care resources for many patients who may have not otherwise sought care. The results of the retrospective chart review will further guide quality improvement projects to better serve the needs of patients. 
Acknowledgement/Funding Source: Thank you to the Camden Community Health Center for the permission for this project. No financial support was required. 
*H2—Osteopathic Philosophy
Rowan Community Health Center Root-Cause Analysis: A Tool Used to Reopen Rowan's Student-Run Healthcare Center 
Patrick Tempera, OMS III1; Christian Diliberto, OMS IV2; Maria Anache, OMS III2; Roma Padalkar, OMS II2; Shelly Sharma, OMSII2 
1Rowan University School of Osteopathic Medicine 
2Rowan Community Health Center, Rowan University School of Osteopathic Medicine 
Statement of Significance: Within the past 2 years, Rowan Community Health Center (RCHC) has closed and reopened. The purpose of this project allowed for retrospective examination to optimize osteopathic student-doctor training, patient access to care, and quality of care. Performing a root-cause analysis helped identify our failures while also highlighting our successes. Osteopathic philosophy emphasizes the treatment of the whole patient - mind, body, and spirit. Our clinic's root-cause analysis allowed RCHC to use this very same philosophy in the understanding that all facets of RCHC must run synchronously while remaining patient-centered. Our hope is that RCHC's root-cause analysis can provoke discussion amongst other osteopathic student-run health care centers. 
Methods: Upon closure of the clinic, the RCHC executive board met monthly to identify how to expedite the reopening process. The executive meetings were attended by medical students from RCHC departments: Executive and Assistant Director, Special Projects and Development, Outreach, Operations, Finance, and Research. Having clinic meetings with all 4 class years served as institutional memory. This allowed us to address successes and failures and served as a built-in consortium of individuals to troubleshoot for solutions. Students involved before and after clinic closure provided knowledge on both how the clinic functioned in the past and provided new perspectives on how the clinic should function in the future. A root-cause analysis was implemented because it identified failures that ultimately led to the closure of the RCHC. The root-cause analysis comprised the topics of safety, communication, patient demand, administration, environment, and policy and procedures. In addition, we included how each shortcoming could be amended, ultimately producing a sustainable and operational clinic. First, we identified the aforementioned topics which resulted in the RCHC closure. Then, we established a timeline of events from the start of the situation until the fault using clinic institutional memory. Lastly, we outlined long-term corrective actions to ensure the fault does not resurface. This has been an ongoing process with the joint efforts of RCHC executive members, faculty, and staff. 
Data Analysis: RCHC's institutional memory with root-cause analysis helped identify failed policies and procedures that resulted in clinic closure. Safety, communication, patient demand, administration, environment, and policy and procedures were the areas of interest analyzed. Below are the uncovered issues identified in each variable. 
- Safety - RCHC did not possess reliable site security, while lacking clear safety protocols and an improper contract and lease signed by the owner of the original site, creating a hazardous environment 
- Communication - RCHC possessed an ill-defined protocol for communication between student leaders and administration, while site location staff were unwilling to discuss outstanding legal documents (i.e. unsigned site contract and lease) 
- Patient Demand - RCHC was found to have poorly defined medical services, lack of services for vulnerable populations (homeless, immigrants, and pediatrics), and unorganized patient resources 
- Administration - RCHC had poorly defined and implemented roles amongst student leaders and faculty 
- Environment - RCHC lacked clinic promotion within the community, awareness by community leaders and members, and support from the site location 
- Policy and Procedures - RCHC possessed an unclear Policy and Procedure manual not well known by clinic staff, faculty, and volunteers, as well as unoptimized clinic operations 
As depicted, the closure of RCHC was not due to an isolated event, rather due to an accumulation of shortcomings. 
Results: Initiating a root-cause analysis allowed our clinic to establish fault management with long-term corrective actions to address our shortcomings. Below is a list of the implemented corrective actions for each of the original root-cause analysis topics. 
Safety 
- Corrective Action - terminated our relationship with the previous site location; thoroughly defined safety protocols with sections outlining emergency, safety, and fingerstick protocols; Communication 
- Corrective Action - created a flowsheet for use amongst clinic staff on how the clinic will function, as well as a protocol for setting up and breaking down the clinic; Patient Demand 
- Corrective Action - established well-defined patient services; built a community presence through health fairs and extensive outreach through RCHC Outreach Department Administration 
- Corrective Action - implemented clearly defined staff roles, volunteer positions, and faculty positions to encourage clinic efficiency; appointment of a new RCHC medical director 
Environment 
- Corrective Action - RCHC established a relationship with the owners of the new site; organized health fairs at the new location to increase community awareness; initiated EMR and configured a Rowan IRT secure network 
Policy and Procedure 
- Corrective Action - revision of RCHC's Policies and Procedures which involved input and consideration from both RCHC clinic members and Rowan SOM stakeholders, providing full transparency amongst those involved with the clinic 
Conclusion: Root cause analysis was originally developed in psychology and systems engineering to provide structure to the retrospective analysis of errors [1]. Root cause analysis is designed to answer 3 questions: what happened, why did it happen, and what can be done to prevent it from reoccurring [1]. Thus, we were confident that implementing a root cause analysis would be beneficial for our cause. As discussed above, the root cause analysis process involves many steps in helping identify and preventing adverse events. Successful root cause analysis involves having honest and open discussion of adverse events; flow diagramming to illustrate the adverse processes that took place; descriptions of how each cause led to an effect; and lastly, developing corrective actions with risk-reducing strategies preventing reoccurrence of adverse events [2]. Applying these steps allowed RCHC to identify contributing factors to clinic closure, ultimately resulting in the re-opening of clinic doors. We plan to develop outcome measurements to ensure proper implementation. We are confident that these changes will allow the clinic to grow more strongly and better established. It is our hope that osteopathic student-led free health care clinics that are interested in optimizing and reducing the occurrence of any form of adverse event, properly apply a root cause analysis to develop corrective action strategies to mitigate adverse events and optimize clinic policies, procedures, missions, and values. 
References
1. Wu AW, Lipshutz AKM, Pronovost PJ. Effectiveness and Efficiency of Root Cause Analysis in Medicine. JAMA. 2008;299(6):685-687. doi:10.1001/jama.299.6.685 
2. Charles R, Hood B, Derosier JM, et al. How to perform a root cause analysis for workup and future prevention of medical errors: a review. Patient Saf Surg. 2016;10:20. Published 2016 Sep 21. doi:10.1186/s13037-016-0107-8 
★*H3—Osteopathic Philosophy
Evaluating Students’ Knowledge of Elective Pregnancy Termination Before and After Educational Intervention 
Elizabeth Weirich, OMS IV; Alexandra Lenox, OMS IV; James O'Neil, OMS IV; Renee Tornea, OMS IV; Gina Foster-Moumoutjis, MD 
Nova Southeastern University Dr. Kiran C. Patel College of Osteopathic Medicine 
Statement of Significance: The medical education system plays a large role in ensuring continuing access to pregnancy termination by educating future physicians on the topic. To ensure this education, the Association of Professors of Gynecology and Obstetrics (APGO) recommends students be competent in 4 objectives on the topic including “providing non-directive counseling to patients surrounding pregnancy including unintended pregnancy.” Despite these objectives being introduced in 1997, studies have shown that medical school curriculums around the country are not meeting them . Pregnancy termination a common and necessary procedure and physicians should be educated in its fundamentals during their training. 
Research Methods: Students were recruited for the study via social media announcements. Recruited participants (n=15) were divided into a control group and an intervention group. Students in the intervention group attended an educational event teaching APGO's pregnancy termination objectives with a student-led PowerPoint presentation. Students then practiced their interviewing skills with standardized patients. Surveys were given to the intervention group before and after the scheduled learning intervention and a follow up survey was also given 4 weeks after the learning intervention. Surveys were distributed to the control group at the same time as the intervention group to control for survey question bias. Student participants in the study were rewarded a ten dollar gift card at the conclusion of the first post event survey and rewarded a second ten dollar gift card upon conclusion of the second post-event survey. All surveys consisted of the same content-based multiple-choice questions as well as 1 likert-scale question assessing comfort in providing non-directive counseling to patients surrounding pregnancy. IRB exemption obtained following standard protocols set forth by NSU-KPCOM. 
Data Analysis: Student participation in the study was limited to first and second year medical students enrolled at NSU KPCOM. Response rate was 100 percent in the pre and post event surveys and 87 percent in the second post-event survey. Data analysis was performed using both homo and heteroscedastic 2-tailed t tests where appropriate. All data was run through Microsoft Excel. 
Results: Pre-event survey data showed no significant difference in number of multiple-choice questions correct between the 2 groups (P=.33), post event survey data showed the number of the multiple-choice questions correct was significantly higher in the intervention group than in the control group (P=.002.) A significant difference was also seen when comparing the intervention group's pre event data to both the post event data surveys. (P=.0005 and .0004 respectively.) Likert scale question analysis showed no significant findings. 
Conclusion: Because our sample size for our study was small (n=15) the conclusions that can be drawn from this data are limited. We hope to repeat our study to gather more data to build upon our educational intervention so we can share it with other medical school faculty with the end goal of providing an effective educational tool for pregnancy termination education. 
Acknowledgement/Funding Source: NSU KPCOM Medical Students for Choice Chapter. 
References
1. Association of Professors of Gynecology and Obstetrics (APGO) medical student objectives, 10th ed. 2012-2014, accessed April 10th, 2017. 
2. Abortion education in medical schools: A national survey.” Epsey, Ogburn, Chavez, Qualls, Leyba. American Journal of Obstetrics and Gynecology (2005), 192, 640-3. 
*H4—Osteopathic Philosophy
Meditation and Empathy in Osteopathic Medical Students: A Longitudinal Randomized Controlled Trial 
Bhuma Krishnamachari, PhD1; Pendyala Ramya, OMS II2; Suzanna Shermon, OMS-IV2; William Blazey, DO3; Jerry Balentine, DO4 
1New York Institute of Technology College of Osteopathic Medicine 
2Department of Research, New York Institute of Technology College of Osteopathic Medicine 
3Department of Family Medicine, New York Institute of Technology College of Osteopathic Medicine 
4New York Institute of Technology College of Osteopathic Medicine 
Statement of Significance: According to the American Association of Colleges of Osteopathic Medicine (AACOM), DOs are trained to look at people holistically from the inception of medical school. Fostering empathy in osteopathic medical students is particularly important as they are the future of the health care workforce and a trend of declining empathy during medical education may lead to decreased health care quality outcomes. 
Research Methods: This study was IRB approved. First and second year osteopathic medical students were recruited into the study. A pilot study was initiated in January 2017, and continued as an AOA grant funded study. Data from 3 separate study cohorts were combined for this analysis. Students were randomized into an intervention group (use of the Headspace meditation app) or control group (no use of the app). The study included 54 students in the intervention group and 54 controls. Students in the intervention groups used the app 3 days a week, 10 minutes each session. Empathy was measured prior to study initiation and after 3 months using the Jefferson Scale of Empathy (JSE). This scale is a 20-item instrument specifically developed to measure empathy in the context of health care. Higher scores on the JSE scale indicate higher empathy. 
Data Analysis: t tests were used to compare the intervention group and control group on all continuous variables. χ2 tests were used to compare the 2 groups on categorical variables. A p-value under 0.05 was considered statistically significant. 
Results: The mean age was 24.9 (SD 4.5) in the intervention group and 24.3 (SD 3.5) in the control group. 60.7% (n=32) of the intervention group and 52.83% (n=28) of the control group were female. Age and gender were not significantly different between the intervention and control groups. At baseline, there was no statistically significant difference between the intervention and control groups in terms of mean empathy score (p= 0.29). In the intervention group, the mean score was 116.6 (SD 11.0). In the control group, the mean score was 114.8 (SD 10.6). When analyses were stratified by gender, no difference was found at baseline, in either the female only or male only cohort. After 3 months of meditation, the intervention group had a score of 118.1 (SD 9.4) while the control group had a score of 112.0 (SD 12.6), and this difference was statistically significant (P=.01). When 3-month analyses were stratified by gender and conducted separately in males and females, there was no significant difference found (P=.33) between males in the intervention group (JSE 116.4, SD 9.9) and males in the control group (JSE 112.8, SD 12.2). However, at 3 months, there was a significant difference (P-.01) between females in the intervention group (JSE 119.7, SD 8.9), and females in the control group (JSE 111.3, SD 13.3). 
Conclusion: This study found that meditation using the headspace app may be effective for improving empathy levels among osteopathic medical students, particularly amongst female medical students. Existing research suggests that there are differences between genders in terms of empathy. (This is consistent with previous research that found a difference in baseline performance on the JSE scale between males and females (4,5). It is possible that males and females may process and react to emotional situations differently, and thus may need different tools to help maintain or grow their empathy levels. In order to better understand long term potential effects of meditation on improving empathy levels among medical students, this study will continue over a longer period of time. Future analyses will consider other pertinent issues such as the impact of timing in the school year (Fall, vs Spring vs Summer) and preferences in areas of medicine (e.g. Surgery vs Internal medicine). If future research shows that student empathy increases with use of a meditation app, osteopathic medical schools may consider implementation of this interventions to promote stronger empathy in students, and ultimately better health outcomes for future patients of these students. 
Acknowledgement/Funding Source: This work was supported by AOA [AOA grant number 2851807727]. 
References
1. Hojat M, Louis DZ, Markham FW, Wender R, Rabinowitz C, Gonnella JS. Physicians’ empathy and clinical outcomes for diabetic patients. Acad Med. 2011;86(3):359-364. 
2. Chen A, Kumar A and Haramati A. The effect of Mind Body Medicine course on medical student empathy: a pilot study. Med Educ Online 2016, 21: 31196 
3. Kemper K, Lynn J,and Mahan J. What Is the Impact of Online Training in Mind-Body Skills? Journal of Evidence-Based Complementary & Alternative Medicine, 2015 Oct;20(4):275-82. 
4. Hojat, M., Mangione, S., Nasca, T. J., Cohen, M. J. M., Gonnella, J. S., Erdmann, J. B., et al. (2001). The Jefferson Scale of Physician Empathy: Development and preliminary psychometric data. Educational and Psychological Measurement, 61, 349-365. 
5. Fjortoft, N., Van Winkle, L. J., & Hojat, M. (2011). Measuring empathy in pharmacy students. American Journal of Pharmaceutical Education, 75(6), Article 109. 
*H5—Osteopathic Philosophy
Underserved Youth Medical School Outreach Program (UYMSOP) 
Joseph Nathanson, OMS II; Jessica A. McArthur, OMS II; Rebecca Ryznar, PhD 
Rocky Vista University College of Osteopathic Medicine (Colorado) 
Statement of Significance: The single most important goal of the Underserved Youth Medical School Outreach Program (UYMSOP) is to increase awareness of Osteopathic medicine to underserved youth in the Denver area. During the day at Rocky Vista University College of Osteopathic Medicine - Colorado (RVUCOM-CO), students from middle and high schools are invited to learn about the basics of osteopathy along with all that life as an osteopathic physician has to offer. The UYMSOP is designed to open children's eyes to Osteopathic Medicine in their hometown and provide them with personal guidance to pursue this field if they choose to do so. 
Research Methods: Ten Denver middle school students participated in 4 stations with medical students at RVU-CO, including CPR, ultrasound, suturing, and human anatomy. Anonymous pre and post surveys were given to gauge their interest in medicine and their competency in basic science principles. The study and surveys were approved by the institutional review board (IRB). 
Data Analysis: Results were statistically significant showing that students demonstrated increased competency in basic science principles, improving from an average of 25% to 79% overall and increased interest and confidence in the pursuit of medicine as a career, increasing over 1.5 points on a 5-point Likert scale. 
Results: Specifically, the scores of the science principles pre-survey (M=26.4, SD=6.50, n=10) were hypothesized to be lower than the scores of the science principles post-survey (M=38.7, SD=6.75, n=10). This difference was significant, t(18)=-4.15, P=.0003 (1-tail). Further, the scores of the interest and confidence scale pre-survey (M=2.00, SD=1.05, n=10) were hypothesized to be lower than the scores of the interest and confidence scale post-survey (M=6.30, SD=1.95, n=10). This difference was significant, t(18)=-6.14, P=4.21E-06 (1-tail). 
Conclusion: Our results suggest that the Underserved Youth Medical School Outreach program can have an immediate, positive impact on underserved Denver youth. Exposure to medicine in a strategically planned set of stations showed to increase science competency as well as interest and confidence in a future in medicine. We plan to further develop this program to reach more underserved youth in their critical teenage years in hopes to increase the number of underserved children pursuing a medical career. We have 4 schools scheduled to participate in the program for the Fall of 2019. Next steps are to continue to increase our sample size so we can further confirm the success of our program in providing a fun, transformative day for underserved youth of the Denver area. We also hope to share our ideas with like-minded medical students across the country. 
References
1. Danner, O. K., Et al. (n.d.). Hospital-based, Multidisciplinary, youth mentoring and medical exposure program positively influences and reinforces health care career choice: "The Reach One Each One Program early Experience" [Abstract]. American Journal of Surgery, 213(4), 611-616). 
*H6—Osteopathic Philosophy
The Long-Term and Short-Term Effects of in Office Patient Flow on Patient Satisfaction 
Emma York, OMS IV 
Edward Via College of Osteopathic Medicine (Virginia) 
Statement of Significance: As osteopathic physicians who are concerned with the whole patient, patient satisfaction plays an integral role in the success of the appointment. If a patient is dissatisfied with in-office wait times they may be less likely to return to the primary care clinic and continue to receive care for their chronic diseases. 
Research Methods: The study was conducted using an immediate post-appointment survey as well as information collected during an annual patient survey. The post-appointment survey was handed to patients at the time of check-in and collected at the time of check-out. It consisted of a list of questions on a piece of paper for the patient to fill out. Questions included: 
Age: 0-18, 19-29, 30-49, 50-64 and 65+. Gender: Male, Female, Other. Length of time from check-in to check-out: 0-15 mins, 15-30 mins, 30-45 mins, 45-60 mins, 60-90 mins, 90+ mins. Length of time with physician: 0-5 mins, 5-10 mins, 10-15 mins, 15-20 mins, 20-30 mins, 30-45 mins, 45+ mins. Satisfaction with appointment, satisfaction with length of time with physician, satisfaction with total time in clinic: “Not at all,” “Somewhat,” “Very.” Patients were asked to circle 1 answer choice for each question. Surveys were collected and answers compiled. Annual patient satisfaction surveys were also reviewed. 3 questions were utilized from this survey including: satisfaction with wait time, satisfaction with time with provider, and likeliness to return to clinic. Majority of patients complete the annual patient survey online via a link sent to them by email, others complete it upon receiving the survey in the mail. No personal identifying information was collected in either study (name, address, medical record number) and IRB approval was obtained to conduct analyses of data. 
Data Analysis: Data was analyzed to determine patient satisfaction with appointment, physician and total length of time in office on the day of their appointment. Not at all, Somewhat and Very answers were converted into numerical values 1, 2, 3 respectively to calculate satisfaction scores. Satisfaction scores were calculated for each time variable. Satisfaction scores were also calculated for the responses in the annual patient survey. These surveys had answer choices including: great, good, fair and poor. Great and good were combined receiving 3 points each, fair received 2 points and poor 1 point. 
Results: There was a total of 412 responses over the course of twelve days. The average age of responders ranged between 43.6 years and 54.7 years with 136 male responders and 272 female responders. 217 responses were collected from AM appointments and 195 responses were collected from PM appointments. Average time from check-in to check-out was reported as 28.65-44.82 minutes and average time spent with physician was reported as 18.36-25.12 minutes. Average patient satisfaction with their appointment was: 2.92, average satisfaction with length of time with physician was: 2.91, and average satisfaction with total length of time spent at the clinic was: 2.87. Correlation between time a patient reported to spend with their physician and satisfaction with appointment, satisfaction with physician and satisfaction with total length of time at the clinic were: 0.1326, 0.08449, 0.05663. Correlation between total time in office from check-in to check-out and reported satisfaction were: -0.1991, -0.1860, -0.2376. Wait time correlation with satisfaction with appointment, satisfaction with physician and satisfaction with total length of time at the clinic were: -0.1997, -0.2372, -0.2929. 
Annual survey satisfaction with length of wait time was: 90% great/good, 8% fair, 0.5% fair; satisfaction with time spent with providers was: 92% great/good, 5% fair, 1.7% poor. Likeliness to return to clinic was reported as: 89% yes, 11% no. 
Conclusion: Patients at this clinic showed there is room for improvement in office flow to increase patient satisfaction with respect to where they spend time in the office. Greatest patient satisfaction with their appointment was seen when their appointment lasted between 20-30 minutes. Greatest satisfaction with respect to time with physician was seen during appointments lasting 45 minutes or longer. It also identified that patients in this clinic who spent roughly 10-15 minutes with their provider during the duration of the study were the least satisfied overall. While it is not possible to expect every patient's appointment to last 45 minutes or more it does reveal insight into what patient's want. Even those who spent a long time waiting were satisfied so long as they had a long appointment, 28.38-34.85 minutes. Furthermore, satisfaction remained very similar in the long-term setting when compared with the immediate survey. Although this study failed to show correlation between the questions asked and satisfaction results, patients are not fully satisfied in the areas evaluated in the short nor long-term settings. This study reinforced the idea seen in other literature that patient wait time is neither the only factor that affects patient satisfaction nor a factor when a patient has sufficient time with their physician. 
References
1. Patterson BM, Eskildsen SM. “Patient Satisfaction is Associated with Time with Provider but not Clinic Wait Time Among Orthopedic Patients.” Orthopedics. 2017 1;40(1):43-48. Epub 2016 18. 
*H6—Chronic Diseases and Conditions
Preterm Human Milk Exosomes Have Anti-Inflammatory Properties Mediated by miRNA-146a That Is Lacking in Donor Human Milk 
Farrah Asaad, OMS II1; Xinhua Lin, PhD2; Claudia M. Manzano De Mejia, PhD2; Monica Hanna, OMS II2; Nazeeh Hanna, MD3 
1New York Institute of Technology College of Osteopathic Medicine 
2Department of Pediatric Research, New York Institute of Technology College of Osteopathic Medicine 
3Department of Neonatology, New York Institute of Technology College of Osteopathic Medicine 
Research conducted at NYU Winthrop Hospital. 
Statement of Significance: Preterm infants display an immature compensatory anti-inflammatory response which may predispose preterm infants to inflammatory injury. It is thought that breast milk (BM) contains protective components against inflammatory injury. Exosomes are cell-derived vesicles released in response to various stimuli and are regulators of intercellular communication. Exosomes cargo contains cytokines as well as microRNAs (miRNAs), small noncoding RNAs, involved in various biological processes through regulation of post-transcriptional gene expression. With this study of exosomes, we can study the importance their function not only throughout the mothers body, but how it affects the infant. Exosomes play a hollistic role in both the mother and infant. 
Research Methods: Preterm BM samples (<32 weeks gestation) were collected in week 1 and 4 after birth as well as DM samples. Exosomes were isolated and analyzed for TNF-a content. Exosomes were also co-cultured with THP-1 immune cells exposed to LPS, and the supernatants were analyzed for TNF-a production. Furthermore, we analyzed miRNA composition of BM and DM exosomes, specifically miR-146a, a known anti-inflammatory miRNA using RT-PCR. In addition, THP-1 cells stimulated with LPS were transfected with miR-146a, and TNF-a production was quantified. 
Data Analysis: In all figures, data are presented as means +/- SEM. Statistical significance was designated at an alpha of 0.05. Graph Pad Prism Version 6.01 (Graph Pad Software, San Diego, CA) was used for statistical analysis and graphing of results. Wilcoxon matched pairs signed rank test was used to compare 2 groups, 1-way ANOVA was used to compare more than 2 groups. A P value less than 0.05 was considered significant. 
Results: Both BM (week 1 and 4) and DM had similar amounts of exosomes. The exosomal TNF-α content was low in all samples. BM (week 1 more than week 4) significantly decreased TNF-α production from LPS stimulated THP-1 cells. However, DM exosomes had no effect on TNF-α production from LPS stimulated THP-1 cells. Importantly, exosomal miRNA-146a was significantly lower in DM compared with preterm BM. Transfection of miRNA-146a into LPS stimulated THP-1 cells resulted in significant decrease in TNF-α gene expression and protein production. 
Conclusion: Preterm human BM (and not DM) contains exosomes that contribute to anti-inflammatory immune regulation in the preterm infants mediated by miR-146a. This novel finding illustrates the differential expression of immune regulatory molecules present in preterm BM compared with DM. Clinicians should support using mother's milk and use donor milk only as an alternative.